CR00910

CRIMIC CR00910

Gene ST6Gal

CG4871

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79355

Images

Construct Sequences

sgRNA sequence
CGGAAGAGGCCGCTCGTGATCGG

Amplicon 5' Amplicon 3'
CGCAAGGCACACAATTCCAAGCATCTGAACTTTATAGCTTACCTATAAAACCGGAACTGGGGGGATTCTTGCTTATCGGCCGGTTTCCGGCAAACATCTGCAGACTCTGCCACAGGCGCCACACGGAGTGGGGATCGATGAGGAAGGCACGTGACTTCGGATAGCGCCGCCTGTACAGCTCGTAGTTGGAAAAGAGGTCGTAGTCAGCGCTAGTGAGCCAATCCTCCAGTGTGCCATTGTACTTGCCCGGATCCCAGGCGGCGATCGTGACGTTCCGGAAGATGGGGGCTCGGGTGAAGTCGAATTCCGGCTTGGTGACCACCTGGGGAGGGGAAAAGTTGATTGCAGCTGCAATCGAAAGTGCGGAAATGCGCTTCAGCCTACTTGCGAATTCACCACACGGATCGTGGTTTTGCTGCCAACATCCACCTCGTGTCCTTGCGTGGGCGCATGATTGAATCTCATCACAATGTCGTGCGTGTCTGGGAGCAGGGCGGAGCGTAGTGGGCCAAAATGTATAGTAAACGGAATTAGAGTAGACGGCTAAATCAAACCGATCACGAGCGG CGACTGATTGTGCATGCAGGTGGGTGCACTGCAGTTGCAAACAGCGAAACTTAACAATGCCAGTTTAACAAGTAAAATTTTACTTTATGAGTACAAAAATTAGTGCTCAAACAGAAAAAATAGAATCATGTTCTTATGCATACTGCTTTCAGATTTACTCACCAATGAAGCGGCCTAACTTGGAGCCAGCCAAGGATCCCGCACTGGAGACGATGGCGCAGGTCTTGATGTCTTTGACGTTGCGGAAGAGCTTTTGACGCGGAAAGAGCCGGCCGAAGGGCAGTTTGTTGAAGGGCGCGTCCTTGCGGCGCAGGACCCGCACGCCCGCCTCCATGACCAGGCAGGTCGAGGGGTAGTACTGCTCCTCGAAGCTGTCCCCAAAGACGGGCTTGTAGTCCACGTTGTAGTGGTTCGCCTGCGACTCGTTTACCGACTCCACCATGGCCTTCTCGAAGGCCCGGACAATGCGCTGGCGAAACTGCTGGGTCTTGTTGTGGCACAGCTCCGAGTGCTTGTCGTGGCAGAGATACAGCTTGGGGCTCAGCGTGAGCTTGGTGTTCTTCGAGACCTTGAGTCGGGGATGCGGAGCCAGCTTGGACGAGTTGATGGCCGGATTCTCGCGACTCTCCACGATGAACTTCTCGTTGGGGTTCCAGCGCACGTGGAACACACTGCGCGGCACGCGGTGGCCAGTGGTCCCATTTCCTGTGGGAATGCATTTCCAAATTACTTTGCGCAATCGCCTCTCCGTGCCAGTACTGTTTTCATACGCACCGTTGCCGGGCTGCCGCGAATTCACCTCGCCGGGTTCGCGTCCCGGCTGAGCTTTCACACCCTGGATATGCCCAGATTGAATTATTAATGCGGCGCACACG


Search Again