CR00908

CRIMIC CR00908

Gene CG4630

CG4630

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79354

Images

Construct Sequences

sgRNA sequence
TAGCCAGTTACAAACTTGTTAGG

Amplicon 5' Amplicon 3'
TCGTTTCGCCCATTTGCTTGCGCAGCGATTCCAAAAGGCGCTACAAACTCCTTAATCGCTTCGGTCATGTCAGCGATCGCCAGTTGTTTGAGGGTCTCTTTGGAAATTGAATATACATTTAGGCGATTGTTATACCAGAGATACCCATTTGTTAATATCTGAATTAGAAAATCATGCCATCTTTTTGTATACAATACTTTATAACGAGTATTTTTTAAGGTCAGCTACATCGCTTTATATAAATATATGTGTATATTGCTGATCGGTGGCAAATATGTCCATCCAAACAAGAATGAATCACTTTCCCAATGCAATCGCCTCTTCCACCTGTGAAGATAGGAATGTTTAGCACGGGGATTCTAATACTCCGAGTTATAACTTGCCGTATCCGGTAGTTTTCGGTTGAAGGTTTCCGGCAGTAACAGCGAGAGGAGTCCAGCCACGAGCGATAGTGTCCCGAAAAGTAGCAGAGGTAGTGGGTCATAGTACGAAGCCTGTCAAAAATCAATCCGGATTATATGATTTGCCCTGAATTCTGGACTGAACTCACCAATAGGGGCACAAATGGAGCCAGCATTGCACCGAAGCGGGCAAATGTGGACATCACACCAACGCCGCCGCTCCTAATGACCTAGGATAAACGAAATGGAAACTAACCTGCTGATCTGAGTAAATGAGTTATGTACCGTGGGCATCATTTCCGCTGTGAACGTGTAGATGACTGCAAAGGAGGAGGTGATGCCCAGTTTTCCGACCAGAAAGAGCGTCACAACCAGCCAGTTGGCACCTAGAAAACCAGGTGTATATTATTGCCAGGCAAACCGGAGATATGTTAAAGTGTAAGGCTATCCTTCTTGGGAATCTAGGGAACTTACAACTCCACGAGTGCCTACTCTCGACTCCAGTCTGGCAGGGAATCCAATCTCCTTGCGCTTAGCGTGCATGCATGGTGATTTAGATCGTTATTATAATACTACCCTTTGATGAAAATGAAAAATGAATAATAATTTCACACCATCTACTATATGGAAATCAGTCTAGATGGGCCTAACAAGTTTGT ACTGGCTAATGAGTCGTATGAGTAATATTTAGTGATCTCAAAACTGATCGGAATCTGATTCATATCTTACCTAGTGTAACGAATCCGCTGGCCACACACGTGATAGAGCAGAGCAGCAAGGAGCCAGAAAGTGCCACACGTCGTCCAAATCTCCGCAGGAACAGCTACTGGCGGAGGATTAGGGATGAGATTAGTCACGTTTCCGAACGAAGGCGGTGTCAACCTACCCATGCGAGGCTGTAGCCGGGTATCTCTACGAGGCAAACCAGGGCGAAGTTTAGGTACTTGTTGCCACTCAAACTGGTGGCGTTGAGCGAGAGTCCATAGTAGACGATGGCATTGACGGCCCAAATCAGCAGCAATATGGCGTATCTGCCCATCAAAATGTGAGAGCGCGCCACCTCCTTGACGGCCAACCAGATCTTGTCATCCTTCTTTACGTGCAGGCCACCCTCGACATCATCCTCTTGGCCCGTTTCTGCATCAAGCTCCTGTTGCTTGAAGCTGGCCATCAGCTCGACGGAGATGTCTC


Search Again