CR00904

CRIMIC CR00904

Gene CG14763

CG14763

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79353

Images

Construct Sequences

sgRNA sequence
AAGTCACGCCATTTCTTGTGGGG

Amplicon 5' Amplicon 3'
AATCCGAGCAGTTCACCCAGTGCATGTGCTGTGTATGCGTGTGTTCGCAAATCTATTATTTATATATATATATATATATCAATCGTAATATGTACACTCAAAGGTAGTAATAACGATCAAACGCAGTTGTCTTGCATCATTAGACGGATGTTCGAAAGTAATTTATGCTTCAACAAAATATTATATCAAACTATTGTACTGATATCCAAATAAACGACAACTATCGCATCCTACGTGTTAAAAATGTGAGTTGTGAGTTACAGTGCAAGCAAGTGTTTAAGAAAGTGAACCATCTGCTGACCAAAGAAGGTAACGAAATTAAGCACCATTGCTAGCATCAACATCAATTTTATTACCAAGTGGAACGCGCCAGGGCCCTGGAATCGCGTTCTTAATCGTAGTACAGGTAAAAGGTGGTGCAGACTGCAAAGTACGAGGGTCTCTCCACGCTGTAGGTCACAAATCCGTCTTTTTCAGCATCCCACAGGAAGTTGACCATGGAGTAGAGGCCCTGCATCAGGAACTCGCCCACAGTGACCAGCACTATGTAGCGATATCTGGGGCGAAACGGTGGTTAGTTAGACAAAAACTGACCGCCGAACCAAAGTCACCTGTCGTAGTTGTCGAGTTTGATGCGGTTCTTGATTTCCTCGCTCACTTGCGCGGCCATGTGGAGGGAATGCTTGGGATGGAACATGTACTCATCGTTGTAGTGTCGGTTCATCACCGCCTTTATGATGTTCTCCACGCGTTCCTTGTTGAGCGGATTCTTGGACTCCAGGCGGTAGGTGGGCATGAACCGCATGGTGGGCTAGGCATTAAGCAGATCTCAGGGTATAAACACAGCTAGCTGGGCATTTAACGGACTTACCTTGGCTGCCGGAGCACCCATCGGCAAGGAAACGCCCATATGGGACTTGGTCAGCGATCCGCGCTGGCTGCTTGCCGGCCTCTGCATGTCGATGAAATGGGAAACCGAATATGCATGTTAGTTAGGCCACAGCTAGAAGCACAGAGATACCCAAACCCCCAATAGAATCCCCACAAGAAATGGCGTGAC AGAAATGGCGTGACTTCGTCAAATTTTAGACGAACCGTATGGTTCCCGTGTTCACATCCCGTTACAAGCATCAATTCATTAAAAAGACATCAATACCCCATTGTAACCATAATGGCAAAATCAATCGTATACCTTCTCACGCTCCTGGCCCAGATAAAGATTCACCAGCCCCGACCAGTTCTTCGCTGCAGCGGCTGCCATTCCTTGCGAATTAATAGAATCGAGTCGGCTCGAGTGCGTAGAGGTTAGCCATAAAACCACAAATGATTATGCCATTAAGTCATTCCCTGCCAGATTACCTGACGGCCTGTCGCCGTGGCAATTCGTGGCGTTTGGCTTTGTTGAATCAATAAAACCAGCCAAATTATGCGCCACTTGTCAGCCCAACTTACCGGCTTAGTGCCCTCGGCCGACTTTTCTTTCTTCTCCTTTTTGCCCTTGCCAGTTTCCGCCTCCTTGGCGGCGGTCTCTGGCACGACATCCTTGCTGCGCCGCTCTTCCGGTGAGTCGCCCATGATCACA


Search Again