CR00903

CRIMIC CR00903

Gene CG8735

CG8735

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79352

Images

Construct Sequences

sgRNA sequence
ATTCGCTGTATACTACGTTCGGG

Amplicon 5' Amplicon 3'
TGCTTCTTGTCGCCAAAACGCTCCAGGAGATTCACCGCCACCTGGGAAATGCATAATGGTACATGATATAGTTTGAAGTATCTAAACAGAGTGCATATAAAAACAGGCGCGAACTCGACTTTGTGAAAGTCGATAAATAGCTTTTGCGTTCTAGTCTGATTTGCATTGATATGAGTTCTTTAAAACAGCTGTGCCCTTTCTATGGTTTACACTACGCATCTTAGCCGAAAATAAAGAGAATATTCTAAGCTCTGATAAGGACTCTGCACTCGGGCATGTAATCAAGGGGAAGTTGTGACCCCACCTTATAGGTCTCTTTGTCCATGACCTGCTCCAATATCTTGCGCTTGTCCTCCTTCAGACGAGTCAGCTTATCGCCATTTTTGTTGAGCTTGCGCTGGAAGTACCACGTAAACAGCCGCCGCAGAAAGATGATGCTAGAGCCCGGGCGAGAAAAAGGTGGGTCAGGAACCGGATTTAGAGCGGATTAGACGGCAGCACTCACACAATGGGGAATAGCAGCAGCGGTACCAGGTACATGAAGCACTCCTGCATGGTCGGCGGGAAGTAGAAGTACCACCAGAGCCCGAAGCCCACGATATATGCTCCGATGGTGAAGCCCACGAAGTTCGTCACGAACCGGCGCTTGCGCTCCTCGGTGTTGATCATGTACTTCTCCAACGCTTGGATCTGCGTCTGCAGCCCCTCCAACACCGCCTCCGTGGACTTTTCTTTCTATAATTAGATTCGCGAATTCACGACACATATTTTTTGGGGCTCTTAGTATATTCGC TGGGCCGCTGCTTATACGCACCCGCAGCTTGGATAACACAAATCCCATGGTGTATGATCCGCAATTTAACTAGAAACGAACAAACTTAGACATTTACTTGACTATTTTGCTATTTAACCGCCCGCTTGCCTAGATATTATTTGCGCTCAGCGTGACCGTGCCTGTACCTTTCGAATACACCGCGGGAACCCACCAAAAATACCAAATTCCTACAGTGCTATCGCGGACTCAAACCACGAGAGAATGTCCAATTGGAAATGTCCGCGTCTGTTCAAATTTCAAACTTTAAATATTTCATATTCTTATATGAAACCAATTTGAACGATTGATTATATTCATAATGGAACATTAAGTACTGAAGGTAAAACAAATTTACGAAGCATTGGGGCCTGAAGAAAATGAGTGTTAGAGTCGCCATTATTCACATGCCTTTATACTTAAAAACTATTTTTGTGGAACAATACGCCTTTTAACAAATTGTTGTTACTGTTAAGTTATCAACTATCTTTAAAGAGCCTACAAATATTTCAGCTCATTTCATTTGAAAATATTGCACTATCGTTAACAGAAGCGCATTGTATTTGGCCACCATCGAGCGATGGCCACACTGCCACTGCCTCGGCCACACTGCAGTTCGGATTTGCCGGTTGTTTGGATCGCAGATTGAATCGGAAAGCCAGCGGCGTTGGTTCGGAAAAGTGCAGTCTCCGCGTCGCGAGTGCGCCAATAACGAGAAATAACGAGAATTGAAAAAGTTCCTTAAGAGGTGGAGTCCAGTAAAGCGCAGCAGCAATGATGCCGCTGCAGGAGTCGCCGTCGCCCAGTTGGCAGCTGGAGGACTACGCTTTCTTCCGC


Search Again