CR00902

CRIMIC CR00902

Gene CG15099

CG15099

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79351

Images

Construct Sequences

sgRNA sequence
ATTAAAAACAAGTCGAGATAAGG

Amplicon 5' Amplicon 3'
TGGTGAGTTTTTGGCCACCTCGCTGCCCAAAAGCCAGCTGAACAATCTTCTATTCAGCGACATGTCCCGCCGCAGTATAGTATTGAGTCCATTGGTGACTAGTTTCACTAAATCATCCTCGGAGAGCAGCACCGTATGCATGGGAAAACCGAGCAGTAGGAACTCCAGGGTGTTTCGCTGGACCAGGATCAAGGAGTCATTTAGGCAGACACACAAAGCTGACATCATGATCTCTCTGTTGTGCCCCATAATGTAGATCTGCTCCTGCATGTCCAATCGCTTGTTGAAATGCTCCAGCAGGTAGGTGATGGCCGGCAGTCGAATTGCCGCATTGTTGGCCACCGATTCCCAAAGAACTGTGTAAAAGTGCATGGGATTGACGGCATTGCAGACTTGTTTTAGTAAAGCGCTAATTCGCTCGAAGTGATCCAGACCGCAGTCGTAGCCAGGTAGCACTCCGTTCAAGAAACCGCTTAGAGCGGGCCTCAGTTTGTCACCCAGGGGTACGAAATAGGTTTCATAGATGGCCAACAAGGCGGGTCGTACATTCATGGCCGCATATCCAAGGAGCGGAAATAGCCCAGCGCTGCAGGCAAAAAATACATATTGTTAAGAAAACAAACGAAGTTATCTCGTTCACTGACCTATATATAAACTCCGTGGCCAGGCGCTCCGGTCCTGTTTTGCTGAATATCACCGAATAGGTCTCCAGGGCTTTCAGATGCACCCCGGAGGGCAGGGCGGGATGCATGCATTGGGCCAATCGCTTGGCTATCTTGAGTCGCCGGGGTATGACCTGGTACTGCGTATTGCTCGATATCGCCTGTCGAAAGAGGAGGGCACAA TCAATGGGTTCCCGGAAACTGCTGTGAGTCAGTTGCTCCGACGTTTATCTGTATTGCCACAGATGGAACCATGAGTGTTATACCTTGCTGAGCTTGCCCAGAGCCGATATCAAATCCGCCCATTCGCTGGAGTACTCGAAATTGCGCAGCGCCTTGTCGATATTGGTCATATATGTGCGGTACTTGGCCTCGGCCATAAGCTTCTGCTCCTCGACGAGTGCGTCCGCGGATTCCATGGCGACGTCTTTTGCCAGTGGGCTAGCTGGCTCTAAATGTTGCTTTTTGCTTGAGTTCGATGATTTCTTGATGGGTTGGCTTTGTGGCAGAGCTCTCTGTGAATAATCAATGGCAATCAATTAGCAAACACTTGTTGCCCGCGGCGCTGCGTCCTTGAATTCCAACTCCCCCACACAAATGGGTGATTTTCTTTTTTTAGTTCACTAAAAGTTTAATGCTTTGCATATTGGAGCAGTGTGGCAGCCGAAGCACCTGTGAAAAACTGGCGATTCTTTCGCCTAATTGGAGGGTCTGTCAATTGACCCTACATTGAGTGTATATATATTGGAAGCCTCGACGCGCTTGACTGCAAAATCGGGTTGAAAGTGATGTCGCGTGGCAGGAACAAAATAAATTAATTTTTGAATAAATTTCAACTCTCTCTCTTTCTTTCTCCTTCTCTCACCAGTGAAGTGCAGTTAGAGCAAAGAAGAGAGGGGACCAGCTGATGACGAATATTCTGCTGTTTTCATGAAAGCAGGTTGGAAGGGGTGGGGGCTCGTGACGGGACAGACAAA


Search Again