CR00901

CRIMIC CR00901

Gene Nha1

CG10806

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no rxn no rxnOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATAGCGATCATTCCGCTTATTGG

Amplicon 5' Amplicon 3'
TAAGTGGCGCCCAATAGTCGAAAATACTTTGTTGAATTTTTTAAAATATATATAATAACACTTGCCTTAATTACAATTTAGCACGTTTGCAGAAGAATTTAATACTTCATTGAGACGCCTATGATTGAGTTTTTGAAACGTGCTAGTAGCGAAAATGCTCAGCACACGTGAGAAGTGAGGTGTAGACAATATACGTCGCAGACTATATAAGACATATTTTTGAAATATAAAAGTATTGCGCAGATATATAGCTAATAACCACACAGTTACTTATTTGATATTAATTTATAACAAAACTCTCGCTGACAAACTGCTTTCCTAAGACAAGGATTCTGCGATCCTGGACAACATCACTTACCATAGCTGTGAGTCGAGACCCGATCACTTTCGTTGTCATGGGGAGCGGTATCCTTCAGGATGCTCTTCCTTCGCGCCGGTCCAATGTCCGTGTGCGAATGTGTGGAAGTCTGCGATGGTAATACAAATCGCGATTAATTTTGTTAAATAACAATACGTTATCGCTGGCACTGGTTCACAAGCGTGTGACCATATATACATATATTTTCATTAGTCGATTATATGGCCAGTAGTACATGGAAAATCCGTTTTTACGATGCAACCAATAAGCGGAATGATCGCTATCG GCCGGCGGTTAATGAATTGATATAGCCAACAGCACTCACCTGTGAAATTTTACGCCTCGGATTTTGCTCATAGGCGGGATTATCGTATCCGGTGCCGAGACCACCATTCCCACCGATCATGGGAGGATCGGAAATAATGCTAACCCGTCGCTTGGGTTGGCTCTCGATGACGATGGTGCTCCTGTGGTTGCCAGCCCCATTGCCACTGCCATTCGAATTGGGCATGGGCACATCGCTGGGCACTGGGATCGGAGTCGGAGCGATGATGGTCGTCGGTGTGGTTATGGTCGCTGGTGCTCCGCCGACGGACGGATCCTCGCGCGCTTCTGGCTCTCCCGTGGCCGTCATCTTCTTATGGCTCTGCCGGAACGAAATTTACAATAAGTTAATCATTTAATGCTTCGATTAGTTTGCCTTTGCGCTTACACTAAACATTTGACGGCGTCGCGAATCAAATGTATTCAATTATTTCGAAGCGATTCGCGAGTTTTTACAACTATCTCGTTCGACGTTTAGCAATGAAATAAATTCATTACCACTCGGTGGCAAACCGCCAACTCCAGGTGGACACACACACTCATAAGGGCACACACACACACATACACATACAGGCATCTGGTGGCTACACTGGGCGAAATGGCAAGGCGCTAATTGAAAAGCCAAACAGCCATTTATCAAAGCCCAGGAGAATGACAGGTAATGTGATATAAAGCGTAATTGTGGGAATTAATGCCCTATTTCTGCAATTCATTTATTTATTTATAAACTACTCTGAAAATTAACTAATAAAATATTTAACATTGTCATATAAATATTATGAGAATTATTGTCCTCTTTCTTTAATTTATTTATTCATTTATAAGCTACTATAAACATGTACTGTATTTTATTGCGATTGTGAGTAGTTATGGGAAAAATATTTTTTTAGCTTAGAAAAGTATATGAACACTATTTTTTGATTAAGAATTGAAAAAAAATGGCACATAATTAACTGATTTCGTAGATTACGTATACGCACTGTATGTCTTTTGAGAACAGACATAAATAGGAAGAAAATATATTGCTTTATCTAATGCGTGATTTTTTCTGAACATATATGGTTATAATCTTTAAAAATATCTTAAATATAAAATATTTTTGTTATTATTTGATTTATTTATTTTTCGCAGTGCCCTTGTGAACTTG


Search Again