CR00900

CRIMIC CR00900

Gene CG13197

CG13197

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK wrong size bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TTGGCGGCTCTCCTGTCAACCGG

Amplicon 5' Amplicon 3'
GTGACGTCACCACCGATCTTCTTGGCCGCAGAGATGGTGTTCAGGGTGATCGGATTGAGTACCTCATTGTTGTGCTCAGCCACCACCAAAGTGCTCTTGCATCGCTGCAACTGCAAGTGGGAAAATTGATATTTTGTTATTTAATTTTTAGCGATCACCGCCTGCGCTTTTTTTTTATCTTTTTAAGAAATTTCCACTCACAATGCTGCTGCGCATAAGATTACGCGTGTTGCTGGCGAACATTTTGGATGTTGGATGGTTATTGGAGCTATCCACGCGAGGGAAAATTGTTGTTTGATTAATTTAAGTCCATTAATATTTAATTAAAACTCTTACCTTCGCTGTAAAATCACAGAAAGTCCAAAGGTTTCCGCTGATTTAAGCGTTTGCCGTTTTTTGGTACCTCCTAGCCAATACACAACAGCTGTTACTTAACAGATGGAGCAACAGATCTATGTGAACTTTAAGCAGCAGGAACTTAAGTGAAAAAATGAACATATATAAAATATAATCTTGGAATTATTGATTAATGGACTTATTTAATTTAATTTTATTATCCATTTAAAAAAATATGCAAGCCGATTAATATTACTAGTCATAAATTTGTAAAAGAGCTTAATGAAGAATGAAGTATTAAAAAAATTACATTTATTATTAAATAGAAACATTAAATATAGATTATAAATGTTATTACTTCAGTTAAAGAGCGAATGAGCGAGAGTTTTAAAAATAATCGTGACCAGTCACAGTTTAGCTAACAGTGTCAACTCAGCAGCATATGTTGAGTAATCTCTTAAAGTAATCTGGCAACACTGGAATAAGAATTATTTCTTTGCAAAACATTGTCAACAATTTTGAAGAACTTCGAAATTTTATTTTTAAATTTCGGTAAAAGGTTTGGCGAACAGACAAAATGGTCAAGGACATACCAGACAGGTGAGTGCAGTTTAGGAGAATATCCCAAAGAAACCCGTGTTGTTTATGCTGGTCATTTTTTCATGTTACTTTTTGTACCAATTGCAGATGGCTGAAGTACAAACCGATTGGAGATCGTGTTCCTGGCACTCGTTTCATAGCCTTTAAGGTGCCGCTGAATCAGGTGAGTTCCCGATGATCCTCCGCCCGCCCAGTGGCGTACCACACTCCATCCGAGATCCAAGAAACCGGT CAGGAGAGCCGCCAATTGATGGATGTTGAAAACCCAGGATCTGGACCACCGACTGAGCGGCCCTCTAAAAATATAAATAACAACGAACGACGACGAAATTTGTGCATTGTAATTATGCATAAAAGTGGCAACTGGAACATGGACCCCACATGAATATTAAATTAAATTGTTTTTGCTTAATTAAATAACGCCACGGATCCACGGCCTTTATTAATTGCCAGCCCTCCGGGCATTTTGCATAAATTGAGCAATCTATGGCCGCCCATTGTAATGCCCTCGTATATTTGCTCAGCTCCCTTCTTTTTTTTTATCTTTTGCAGCATGTCAACGCCAAAGTGAAGGAGAATCTTCGGCTGGCGCCCGAATCCCTTCTGCAGATCGTACCCGATATGGGTCTCATCATCGATTTGACCAACACGAATCGATACTACCACCCAAGTGCCATAACCAACCACGATGTGCTCCACCAGAAGCTGATGATCCCCGGAAAACAGACACCCTCGCATAAGCTAGC


Search Again