CR00898

CRIMIC CR00898

Gene Arpc2

CG10954

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK short band81153

Images

Construct Sequences

sgRNA sequence
AATACGCTGTCGACGTAAGGGGG

Amplicon 5' Amplicon 3'
GCTGCAAGTACTGGCGATTGGAAATTGGAGGCGCGAAAAGAGGATAAGGTGGATTTTCTTGCAACTGTGTGTGTGAGCATTGGAATTCGCCCGTGTGTGTGGCGAGAGTGCGTCCATGTGTGTGTGACGGACCAAAAAAGCCGACATCAGCGCCCATTTTTTGTTGTTGATTCATTAATACGCCCGTCATGCACCAGTATTGGTGAGTTGGAGCAGCGCACCGTCTTACTCGCACTCAACGGAGCGCAGAAAGAGCGCAGGGAGCGGCAGAAGAAGAAGCAGCGAGCAGCAGCACCATTAGCGGCAGTCAACGTCATATAATTTGTCATCGAAATTGGCACACTAAAAATAACAGTTAACTTCAACCGCCATGATCCTGCTGGAAATCAATAATCGGATTATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGGTAAGTCAATGCCTTCCAGTCCCGTTTCCCCAATTTCCATTCCACCATTTTGATTTCTATGCTGCATTCCCCACCGTTCTGTTATCACCAGTCGGCTTTGTTATCAATTTCGTTAGCTCTCTCTTTCCTCGGGAATAAATTTGGGTGTAGTTCCAGCCTTGGAACACTCATCGCTGCAGCTCTCTCCCTCCCACACACGTACCCAAGTACAGTGCAGCCCCCTTACGTCGACAGCGTAT ACGTCGACAGCGTATTAGTTAATTCATTACAACTCGCTATTCGCATCATCGGTGCTGAAAATCTGCAAAACTGACTCATCCATTGACGTGCATTCAAACGCATACGCTTGTGATGATCGAAAATATTAGTATTTATTTGTTCCTAATCCCGAAAAAGGATATTATTATTGAAGAAACATTATCAAAGGAGTCGTGTTACGAAAGAAATATGTTTAAGCTAAACGGTTTAGAAGAAGCTTAGACGAAGCTTACAGACTAACAAAATTATTAAAATTAGTAAAATAACTTATTGTACTAACAGCACTATCAGCAGAAAGAGGTATTTGTGTTTGGTAGCGAATGATTAAGATCTCACATAAATAAATGTATTTAAATGCTAATAGTTATGATGCCATTAGTTTATTCCCGATAAGATTGCAGTGTAATGCCTGAAATTAAGGCAATAAAAGTTATAAATTGTGGAACAAAAGTGGCATACTTGGAAAAAATCTCCTGTTGTGTCTCAAATGTTCCAAAATAAACCAAAAGGACGAACGGCATCCTGAATAATCAATCATATTATAGCAGATGACTTGTGTTCGTGTACATAAAAACTAATAGTTTCAATATTACTCCCCTATTATCTGTATTCTTGGGAGACAAAGTTTACATGCTAAAGATTCTCCATTTTCCGTGTCTACAACGCTCCGATATAAATTGTAACGCTTAAATCATCTTGAGTAATTCTTTTTGTTTCTTAAGATAAATACTTTCGTGTACATTATTGCAAATTTTAGGCTTTGGAGCCAAAGTGGCATTCTTCAAAAACAATATTTGATCTGTGTCTCAAAAGCTCCAACATTAACTAGAAAGACGAACGGCATCCTGAATAATCAATCATATTATAACAGATGACTTGTGTTCGTGTACATTTGCCATAAAATGTTCAACTTTTGTAATATTCTGGAGTCAAAGTGGCACGTCTTACGATCTTCCTGTAACTTGTGTCTCAAATGCTCCAATATCAAACGAAAGGACGAACGGCATCCTGAATAATCAATCATATTATAGCAGATGACTTGTGTTCGACTACAATAGTATTCGATTTATTAGACCAATAATGCCTCGGGAGAC


Search Again