CR00897

CRIMIC CR00897

Gene CG13229

CG13229

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79350

Images

Construct Sequences

sgRNA sequence
TCGTGATTACAACTCCCCCTGGG

Amplicon 5' Amplicon 3'
CACCGCCAGCCACTTAAGTATATTATTTATGGGCGTCTTGGCCATTTCCTTTCTGGTCAGGACCATTATGTTCAAGATGTTTGCTATTGTCCCGAAAATGCAAATCTAGGTGATTTAAAGAAACAAGAAAGAATCAACATAAAATGCGTCCTTTGTCAAATCGAAACTGTGAGCGCTCACATACTTTCAACTGAATGCACTCCCCTTGGACACCAAAGTGGATGAATATTTTATTTATTCAGCTCGTGAGCAGCAACTCAACTGTCGTGACCTCTCGTATTTACATTTCTTAACATTGCTCACACAAGCAAAAAAAAAAAAAAATGGAACTACAGTAACCGAAGTTTGGTTCAGAATTTTATTTCAATTTAAGAGGTAAACTATTTTTTGTGCGAACGAAGGAAAGCAATAAAGTTACATTTTTCAACTGTATTTGATTTATTGTATATTTATTTGAAAAGATGGGCTATGAACTAGCCTTGATGGAAATGGATTCTCGGTATTTTCTGACCCAATTCCTGTGGTAAAGGCCGTCTGCTACAACGCAAAATGACTTACGACTGAAAATTATAATGAAAAAAGCACATTAACGCCTCAACGGCTTAACTACATCTAATATAATTTATATCCTTTTCAAAAAAGCCCTGAAAAGGGAAACCCGGACATAAACAAAAGACCGAGATTCCCGGCCACTAATTTCATTTGTGATTTTGATGGTTAAGCTGAGCGCATGCTATAACTTTAATTCGAAAAAAGGACGACTTTGGCAAGAGTTCAAAGGTAAAGAAGTCCCCTACATTCATCAGTGGTCTGTCGGCGAAGGTCTGTGTGTATCGTCTTGGCTTCCCTTGCTCATCATTAGTCAACCGATTCCTTTGTTTTGGCCAACATTGCGGGTTTC ACGAGTATTACTTACCATCAGCGAAACGTATCCATGGATGCTGTTGTAGGCTCGCAACCAGTTGTATATTTCCCCCTGGCAATAGCCCTGGCACTCATCCACCTGAGGGGTCATGTTCTTCATCTGGTACTCCTGCCATAGCTTTACAAACTTCTCGATATCGGTGCTCGTGAGATGATAGTCCTTCAGAACCGTGTCGTTGAAAGGAACCCGCTGGTGCATATGGGTCTGTCCCATTTGATTGCCGGTCTCTTGCATCATTGTAGACTATCTAGTTCCGCTCTTTTGATGTATATGTGCTAGTTAAAAACTGGAACAAAATTTAAGGAGTTTAAATACATAAACCATTGCTTAGAATTATTTATTTAGAATTAGAATTATATATTTATTTGAATTTTAAAGGACTTCTTGTCATCGAAATGGAAAGTTTTTCTGTGCTTTACAACTAACTTGTGTTTTACAGGACCATTAAAGTGAAAATGCCATAATGTTTTACAAAATAAAAGGGAAATTGTGTCATTTATGTATAAAATCAATACTATCATCAAAAATGAATTAGACGTCAACAGCATCTAATTTATCATTACTTTGTTATTATCAATGCCGTTTCTTCATTATGGGCATACGGTGTCGAAATTGCTACTGCAACTCGTCAAAGCGATAAACAATTTTGAATGGCCAAAGTGGAGCTGCCAGTGAGCTGAGCAAACCTGTCCAAATGTCCACCTGTGATTCAAAGCAACCTGGGCGTTGTAGGCAATTAATTGGCAAATGCGGACCCATTAGTCTGTGTATCTATTTGCAAGAACTTCACATTTTGCATTTGAGAATATGGTTAAAATTGCTAGGAGATCCAAGTAAAAAATTCTTTAGATACTTTATTATATTATATTATAATTACATTTTAATGGTAAATCCATGTTCGTCTTTCTGTCCGTATGAATGTCGTGATGTCATAGAATTATTATTGCTTGAAAGTTGATCATTATCATGCATGTCATGCAGCCCAATTATACATTACTACACATGTAAATCCTTTATTTATTTCTTTCAGTGCATAAGTAATGTTGGCATCTGACACTACTACCCCGGATCACTCAGTTGGCCGAA


Search Again