CR00896

CRIMIC CR00896

Gene CG7220

CG7220

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79349

Images

Construct Sequences

sgRNA sequence
AGTTGTTCGAACGCGATATCTGG

Amplicon 5' Amplicon 3'
TTGTGCCCGACAGTACGTACACAGAGACACGTCGCTACATCGGGCTTCGTCACTCGACTCGCCCTGCAGTCTCTCCCACAATTTTCTGGGCGCTTTCCTGCAGTCGTCCCACGAACGTTGCCGCAATTGGTCTACACGAATCGGTTCGCTAATAAAATGACTGCCATGCCCCACGCCCACTCTCGCCTCCTAGGAAAAACGCTGGCATATTGAACTGTGCGACTAACTAACTTAAATACTTAAAAGCAAGCCCAGCAAGCCGAGAGCAATCTGCCTAAAAGTGACAAGTTATAGGTGACACAACAAAAGCTAAAATTTGTGAGAAACTGTGTGAAAACTAGAACTACAAAATGATGAAGCTGTTTAAAAAACCCAAAGACAAAATACCCAAATCGGAGATTTTAACCGAGCCCAAGGAGCCCAAAACACCGCCGGTCTCCAAGTGCGGAAAACCTTTGCAGTTGGACAACTCGCGATGGGAGGCAAGTATATTCGAGATATTAAACCTGAACTTTGGCCAGATATCGCGT CGCGTTCGAACAACTGGTCGTTAATATACATATAGTGTTCCATTGCATCATGAGTATGTAGTATTTTGAGTTTCAAGAAATCTGCGTGAATCTTCTGTTGATTCTCTTCAAGGCTGTACCAAGATTTGTTTTTATTATTCTTGGCATTGCCAAATCCAAACCTTATCGATCAAACCCATTTATCCGCAGCTCATTTGTGGGGGCAGCGGTGCGATACTTGTTTATGGTACAGAAAACGGGCCTGCAAGTGCCAATCACTCGATAAGAAGGGGGATCCGAAAGACGGAAAAACAATCGTCGGTTCTATAAATTTCAGTGACATTTGTTTTTATCTTATCGAGCATTTCGTTTATTTATACGCGCGTAGGCATATAGCGTATATTGGCGTTTGTAAGCCAAAGGAGAAATGGCGCACCGATAAGGCGAGCGGAAAAAATAAGTCTTGAGAACTCTTAAGTAGAATGTCCCAGCTGTAGGTGTGTTTCGCGATAAGATATACGGCGAACTGTCCGAGTCATTAACTAATATAAGTCTTAAATTTTATTTTCTGCCCCACAGCGCCGCCTACACAAAGAGCTGATGTCCCTGATCAAGGAGCCGCCACCAGGCGTAACCATCGACACCGAGAGCGTACAACAAAATTTATCCGAGTAAGTATGGACTTCGAGGCGGAG


Search Again