CR00895

CRIMIC CR00895

Gene Daxx

CG9537

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79348

Images

Construct Sequences

sgRNA sequence
TGGTTAAGACGCAATTCGCCTGG

Amplicon 5' Amplicon 3'
CGAACGAATTGACGACGTCGACGTGTCATTCAGTGTGGCCGTTGGTGAAACGTCAAAATAAACCGTCGTGTCACTTGGCGACGACCGGTCACACTGGCACTGTTAAGCATTAAAATTTGAAGTTGAGCCATGGGAAAATCTATATTTTTGGGCTGTACTGCAAAGCTGCCTAAAGATTATGTTCCGATAATTAAATACATAAACTAGCAAGAAGATCTAACAATTATATTTTTGGTGGAATTCACGTTACCTATCCAGAGGGTTATTTATGGTTTCTTTTTTGTCTAAGATGGGCCAACATATTTAGCTTTTGACATGTACACATTTGGTTTCAGGCATTATAGGGTTAATAAAAAGGAGTTTCGATATTTAGTTGTGTGTCCATCGCTGGCACCGGCTGGCACCTAGCGACCGATACTATCGTGGCAGCCAGCGATGTTTTAGCAGCTCCAAGACTCTCCAATTTGACAATTCTGAGGCATGAGTACAAACAAACACTCACGCAGTGCACTCTGTTGGCGAGCGTAATAAATATGTGGGAAAATTCCCACATATATACAGTATTCAGTGCTAGTGCCGAGAACTCGCAACGAACCCGGTCGCGTCGTTCACATATGTGTGAAAAAGTAGCTGACAACAACGGTGGCAAGTCCAAATGCGAAGAAAAGCCAGTAAATCGCGCGGCGAGTAAAGTGAATAAATTCGGTGCAGACCATTGCCGTTTCGGGGCGAATAATGTCTGCGTCTGTGATATGCGTCGATTTGAGCTCGGAGTCTGATGAGGAGGTAATATCCCGATTTCCCAGCGGACTCGTCAGTGCGTGTGTGTGTGAAAAAGTACAGTTGGTTTTAAATAGGCTCGCTGCATGAGTATGTGTGCGTGTTACACATAGTGTGGAATTAAATTTTTTTCGCGCTGCTTTTTTATTGAGAACGAGCAGACACGAACGTGCAGTGCCCCACTCATACAGTTGCAAAACGGTGACAGTGCTGCCAGACCGAGCGATTGGAGACCTGGCGAGTCTTGCAGTTGCACTGGCGAATATCGGACTTTAATTACGTTAGGCGTGGAAATGAGCGAGTGAGAGGGTGCGGTGAGTCTCCGCTCCTGGAGAGTGTTTG GGAAAGTCGTCTCCGCTGATACGGCACTAAATCAAATTAACTCTCCAAAGCGCGCGCACGCAACTCTCCAAAGCTCTCGCACACACCGACGAACGCACACCTATACACTGACGCTTTTCGTTTGTTTATATTTTCATTCAAATTTAAAATACATCTGAGAGCGACCAACAGGTCGCCTGCAGTTTGGAACTATTATAAATGTTGCTAATTATAAAACGCGCTTCAAAGACGATGCACTTGTGATAAAAACAACAAACATTATGTATACTTATAAGTAAACTTTGGTCTTATTGTCAGAGGCAGTGTAGTCTCATCTTATTACCAATTGAACATAACTTGTAATATAAGTTTCAAATTATATTTGCAGTCGCCGGCCAAACGACGACGACTCGAGGATCCGCTGCGACTACTAACGCCATCCGGTAGGCAAAGTTTTCCTGCCAAACTTCTGAACATACCAAAGGCCTCCCTGGGATCCGCGATGGTAGTGCCTGTTGCGGAAACAGGACCTGCAAGGGAGACTCCGGTCATAGTGGATCCACTCCGGTCCATGCACATCCCCAGTGGAATCACCATCACTAAGCACCAGAAGAACGTCCTCGCCACAAACGGAAACATGAACCTTTCTCTGGCAGAGAGCAACAACAACAACAACACTACCAGCTTGAACAAAAATGTGACCCCGAAGCAGATCAATGTTGGCACCGGCCAGAAAGTGGCCTGGTCGGTGAGCAGCAAGGCGCCCAGTCCGAATGCCGTGATAACCACCGTGCCCAGCCACCAGGTGAGGGTGACGCCGTTTAATCCGATTCGACTCGCACCCGGGTCAAAAATAATACCGGCTTCGAATGCGATGCCTGCAAAGATTCAACCCATTCTTGGGATGGGTCAGCCTCAGCAACAGGCACAAGCCCAGCAACCGAAGGCCATCATAGTGGGTTTTCCGAAGCCCAATACTGCAGTGGCTCAAATGGCGCAACACCAA


Search Again