CR00894

CRIMIC CR00894

Gene CG42360

CG42360

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79347

Images

Construct Sequences

sgRNA sequence
CGTCATGGCACCAGGTCAACTGG

Amplicon 5' Amplicon 3'
GCACATTGCGGTATCAGCTGTTTCCCATAGCTTTGTTGAGTCGATAAAGATCAGAGTTTTAACCATTTAATGCATTATTCAGAAGCGATTGCCCCGAATGAGCGAAACCAATAAAAACAAGGATCCCACGGGGACCAGTCTGAAGAAGCAACCTTGGCACAAGCGCGGATCGGCCTCTGCAATGGCCTCAAATATCTTGTTGCAGCTGGCGGCCGAGGATCCCCAAAGGGACGCTTATCCTAAGGACACGGTGGTAAGTTGCCTGTTTTATAAATGAAATCCATTTTTGCGACAATATCAAGCCCGCGTCGGCGGCACGCGCAGTTTCTGTTTTCCCGCGAGTGGTAACCAAGTGGTGGTAGGGGCTTCTTTGGGCAGTGCGCAATCGCCAGCGCCCTGCACCCCACATTCCCATCGAATAGTGAAAAGTTCCAGAAAGACCAGCTCCAGCCAACTGAATCACTGCTGCCGAAATCAGCAAGTCCGAATCCAAGAGGCCAAAGTATCACCTACAACCCACCAAGTATGGAGAAGATCTGGAAGAAGGTGTGCGAGCACCACGATGTGCCCGAGCAGGTGGCCAACGAGTGGTTCGCCCGCATTCAGCAGCACCTGAGCTCCGAGGATCCCGCTCGCGCCTACCACAATTGGGAGGAGATGATGCGGCGCAAGGAGCCGCACTTGGCGGGCGTGGCCAATCCCAACATTGTGCTGGCCGCCTTCTTCCAGTACTACCACTTCGATGGTAACCGCAGCTGTGCGGAGAAGAACTGCGAGGTCTTTGAGGAGTTTTGCAATGATGCCGTCATCGAGGATGTGAGTAGGCGTGCGGTGTAACTAAACCTCTATATTCGGCGTGCTCTACCTTAAACAGGACCATGCAAAAAGCCTGGTATGTAATTTGCTGGGGCGCAAGACCCCGGAGAACCAGTTGACCTG CATGACGACGAGGCCAACTTGCTGCAGGACGTAGACCTGGTGGTCCTAGCGTGAGTATTTGTGCAATCATTGTCCGTGTATTTCAAAACCCATTTACACTACTAAAGTGCTTCGCCGGAGGAGTACAAGCACTATACAACTCTCCTTCGCTCGGAGTACGCCAATCTCGACGATGCCACCTACAAGGCCATGCGCATCAAGGTGCTGGAGACCCTGCTGATGATTCCCTCCATCTACGCCACTGGAGACTACCACGACAAGTACGAAGAGCTAGCCCGCGCCAACATACGCAACGAGATCAGCGAGCTGAAGAAGCAGTAAATCAGAGTTGGAGGACCAGGATGTAACGGGGCTGCTTTGTTTACTGCTGTTGAGTTGTGTACTTACTGGCCGTTTTACCTCGGTTGACTGCAAGGCACTCGTGTATTGGTTGAGCAACCTTCTCTGCCGAACATCTACTTAATTTTACTCCTAAGTGAAGTGTAATCAAAATCATTTTCCTAGTTAGTGTGTACGCCTAGATATATACGTAAGCCCTGTAAACTCCAGCTCAGAATAAAATTGATGTAAATGATGTAACAGAAATGCAGTTTCACTCAAAGCACTTAAAGAATCAATGTATTTGAAATCGCAGTAAGTAGGAAAAGTAACCGTAGAAAAACTTTTCCAAAACTATGATCAAGTCACAAATCAATTAATTACATTCCATTTTTCCATTTATAGATCGCAGCACAAGAAACAGGGGCCTCCAGCTCAAACACCAAAATGCCCAAACAAGCCGTTAAGCACAAGGGCTTCAAGAAGATCCGAGGCCCTAAGCCAAAGGTAAGCAATCGAAATATAAATATATTTGTATTATAGTATGCGATACTCCACAGAACGGCCAGAAAAGACTGAAGCGCAATGCGACTCAGAAGAAGGCACTTAATCGAGAAATGGTATCCAAGTTCCTAAACTCCATTAAAAAAAAGTATGCACTGCAGAAAAATCATCACATTAAGCGCAGGTTGGACTTCCGCAGAAGGGAATCGCCAGAAAAGAAAAACGCCCTGCCCAAGCCGAAGTTCTACAACCCGAATAAGGTAATGCTTTTATAGGTAATATGTTTCAACAATATAACATTCTGGTCAACCGAACATCAGAATGACAACAAAAAAGAAGAAGGAGAAATCGTCACAGAGTTGGACAGC


Search Again