CR00893

CRIMIC CR00893

Gene Ate1

CG9204

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK81152

Images

Construct Sequences

sgRNA sequence
GTAGCGGGAGACTTATACTCGGG

Amplicon 5' Amplicon 3'
GCCATTCATAGGTCTCCGGGCACAGCAAGTAAGAGGGGGACAACTTGCCCTTGTAGCGCATTTTGGGACAGGAGTGTATGTAGAAACCCATATAGTAATACTTGAGAGAAGGCACCTTCTCGGCGAGCGACTGCACCAATTCAATTTCCCTGTAAGAATTTCTTCTATGCAGTTTTATCTTTCTTTGCTCGGAATCTTGCTTTACCTGAGTGAACCATATGTGCCAAGCGATAAAAAGCTATAGTCCGGATCGTAGAAAAAGTACACCGAGCTTACACAACCCGGCAGAATGTCAATCACGCCGACGGCAATCAACTTGTCGTCCAGCCAGTACTGCTGATGAAACGAACCGTAGCCCATTTCGGGACCATCCCAGGGTTTCTCATTCTGCAAGCAAAAACGTCCCGGAATTATGAGGTTAGAAGTAAAGCTTTTAAATGTATGAATTATTATAGAGAAAAACCTGTAGGGGAGTCGCCTGCAGATGCTCCTTGTACGCGTCCTGATCCTTTGGCGGATCATTATGTATCGATATCTGATACTTCTTATAGAGCGCAAAACTCTGGGGCAGGGTCCGCCGGAACTCGTCGTCGTAGACGTGAATTAAGCGCAGCTGCGAATACATTTTTGGGGCAAAGATGAATACTCGTTTATAATTACCTTAAGAGGCGATTTGACCAAGAACCGCTGCATACTAGCTAGGGTGAGGCGTGCGGGGTTATCATTATGAACGGTTATTTGGTATTTGCGATACAACGCGATCACTGCATCGGCACAAGTGCGCTCTGTGTCTGAGGAAGCGACTAACACGATCTGCAAGAACACAAACAGCACAAAGACAGATGTGTCTACATGTAGCGGGAGACT ACAGGAAACACATAGGCGCAATATACAGTGTAAACCCTTATCAACATATGTACATAGGTTCACGCTATCCAGCTTAGTTTTGCAAACGGTCTAACTAATTATTCTATCCACATTTATTCGCAACGCACCTTTAGCCGATGTTTGTTTGTCTCGCTGTCCGTGTTCAAGAAGTCGCGAAGTGTCTTTTCCTGGGTAAGGGATTTCGTTGAGTAGGAGGCCGAGTCTCCCAGCTTGGCCAGCCGTCGATCCAATCGCATCTGCTTGGCCTTCTTGCACGGCTTGTTTGAGATCGGTGCTGCGGCTGATGAAGATAAGAGTGATGCTAATATAATAAATAATATATATATTACTGTGGCATTAAGGCATTAAGGAGCATACGCACATTTGTTGGACCCCAACGTAGGAGCTTCCACCGCGGCAGCAGTTGCCTGCTTCGTCGGCTTCCTCTGAGCCGTTGCCAGTGATGCAACTTGCTCGACATTGATAACAGGGGGACTCTTATCTGGCAGCTGGGGTTGCGGTTCGCTGGCCGTGACCTCGGGAGCCACTATGGCGTAATCGGCATCGGCTTCCCCGTCACCGTCGCCGGCTTCCGGTTTGGACTCTCGCTTGCCGTCGCGCAAAAATCGATTTATGCGGCGAAGTATGCGCTTGTTCGACTTGGAGAGCTTGAACTCCAGGCCATTACATTTGATTGTGTAGCAGGGGCAGCAGGTCTCCTGGTTGCGCAGCTTGTAGCAGTAGTAGCCGCACCGCCGCCAGCCGCGATCGATGAGGTCCTGATAGTCCCGGCAGTCCAGCTGATACGCGTGCATACCTGTCATTTATGACGAATCCACAATAATTGGTACATTGCACCTGGTTTTTGGACTGGTTTTGCATGTTCTCACCGTGCGACAGGCTGCAGTTCGCTCCCGCGCAGTAGCCGCACTTGCTCTGCTGGCTGCCATAGTAACTCACAATGCTCAAGCTCATTATTAAGCTCTTCCGACGGCGTTTATAGTACAAACATATTGCATTTAATTACGACTAAAATATTAAAGCTGCAAGCCGCTCTGTTGCGAAATTTTATATGCAAGCAGTGTGACCAGTGCTCGCCGATTAAA


Search Again