CR00892

CRIMIC CR00892

Gene CG3500

CG3500

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79346

Images

Construct Sequences

sgRNA sequence
AGGCCGCAGCAAACGCCTAAAGG

Amplicon 5' Amplicon 3'
GGTGGCCGACTACACAAAGAACTCCATCCGCCTGGGCGAGCAGTGGTGCCGCGGCGTGCCCATCGAGGTGGCGCCCATGGCGTACGTGCCCATCAAGCTGCACATCGAGGCGCTTTTCGGCGGCGAGGCCTCGTTGCGTATGGCCAAGGTGAAGGCGGGACCCATTGTCACGGACAATGGCAACTTCCTCCTGGACTGGAAGTTCATCGCCAACAGGGAGTACGACTGGGACGAGGTCAACCGCGCCATCACCCTCATCCCGGGCGTCCTGGAGACGGGCCTGTTCGTGAACATGGCCCACAAATGCTACTACGGCATGGCCAATGGCTCGGTCAAGGTCCAGAACAAGTAGTTCTTGGGCGGAGTTGGGGGAGCGCTTTTTGCATTTATGTTTCACCAAGTTGTTCCTTAAATTTTAGGTTTGCCATTTGTAATGGATTTAAATACATATTGAGTTCTTAGCCGAGAAAACGATGTGTCCTAACTTGAAAGTTTCAGCAAACGAATCTTATTCAGCTTCTTCATTCAAGTATAACATCGAAATACGTCCAAATCACCACAAAAGGGTATCCATTACACTGAAATCAGACCCACTAAATCTCAATTGGTTACAGTTCCACTACAATAAAGTGGATGTCGAATGTCAGTTCACATGCGCTTTGTATACTTTTGTCTCGATTGCGGCTACAAAAATAAATAAACATTAAACAAGCTAGATCTAGAAGGCCTTCTTGGTCCGCCCAGGGAGCAGGGCCTCTTTCAGATACTGGAACAGCGACAGCAGGCCCTGCTTCTTGTTACGCGAGAAGTAGTTGCTGACCACGTCCGGACTGCGCCGGCTCTGGTCGCTGACGGTGGTGGGCAGGACACTGTCATTCGCACTCAGCGAGACGAACAGGGCGAAGGGCACGATCCACATGCAGATGGTAAAGTAAGCCAGCACCTGAAAGTGTAAATTTCCTTTAGGCGTTTGCTGCG TGCTGCGGCCTAATTCAAGTTGTATGTAAACAAACTGATGATGTGGATACACAATGCAATGCATATTGCATATAATGGCTGTATAAAAACGTACATACGTTTGTACGTAGCGAATGCGCTTTCCATGACTAATGATTTATGCAATACATATGCTCACCTGCGTGAAAGGCACATAGACAGTGACGAAATGCTGGAAGGCCAGGAAGTGATTGACCACCAGCATGGCCAGGGAGCCCAGCAGCGGCAGCGAGAGCAGGCGCACGAAGGGGAATCCACTCATGATGCCCAGGTGGAAGCCCTGCGCCACCAGTCCGCAGATGATAAGGCTCCACGGCAGGTCCTCGAACAGCAGCAGCAGGATGTAGACGAAGATCGTGAAGCTGATCAGAAATAGGATGCACTTCCTAGCCGCCGTCGTGTACTCCTCGGCCAGCTCCGCCAGATAATAGAGACCAGCCACTGGAAATACAAATTGCAGACGTTGCAATTGGACAAGTGCGGCTGCACGGCGACAGCTCACCAATCGACAGGGTGAGGAACACGATCTGTATGGCCAGCGAAACCCATCCCAGCAGGTACAGGACGGCCATCTTGCGTACTTCAGGCGGAATCGAAGGATATATACGGCTCAAATCGGCCGACAAAACAAAACAATCCGATTAGAGTGGCGTGTGGTGTGTGGCTCGAAATACCAAACATTTAATCAGCTTGTATAGAAACGGGCACACTAATGCGCAGAGCTGCCAGATATTCTCGTTCCAACGCTTTTTCAAATATTTTTTGTGGGAAACATGAGGAATTTAGGATTGAAATCCATATGCAAACTAACTAATGTGAGCAGCAGCATCCATGGACCATGACTTAAAAATATCTGCAAATGAAGTAAAAATACATTCATAAGTAAAACGAGTTCAATTCTTTATAAAATGTCGGATATCAAAACCGAATATCTTAGAAAGCAACCGTTTCAAATTTCATCTGAAGCAAACAGTCTAGATTCTGCTTTTGATATCCTGCAAATTGTCCAGCCTTTTCGAAAAATCCGTAACTTTTCGTATGTGTTCCATACTCGCACGTGCAAGGATGTTTTGTGCAGGAATAGTGCAGCGTAGACTGAGCATGGGTCTCAATCCAAAGTGAGTAGCGCTTGCACATAACTCCTTCCCTTAAACACCCCATCCGAAATCCC


Search Again