CR00888

CRIMIC CR00888

Gene CG1513

CG1513

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79345

Images

Construct Sequences

sgRNA sequence
GCCAGCAACTGAGATGGCAAAGG

Amplicon 5' Amplicon 3'
AGCACTCATATACCAGCGGCAGACCTGGACGATTCTGTCGCGTGGATCATCCAGATCCGATATTCTATTGGGTAAGATGCTTATGAGTTATATTACTGATATAACGCCTTGAACTTGACCATACTTTATAAACAGATCGGGATGAGCAAAGTAATCGGCGTACATTTCCAGGAGCGAGCGGCGCTCCAGAATAAACGTGGGCAGTACCACTTTCGTGAGGTCCATGCCGATTTTAACCTGGGACAGCAAGTGCGTAATCATCGATCCGTGCGCCTCCATACTGAGGTCCGTCTCTTCCTCCTCCTCGTACAGGGCGTCGTAGTCTATTCCGTTATCGTAGCTGGCACTTCGGGAACTTACTGCGGTCCTCGCTGTCTTAATGCTGGTGTCCGCATCGGCAACACTTTCATCGATCTCTGGCAGCGTTTGGGGGGCAACTGAATCGCCCACAGCCACTGGCTCGGCGTTGGCAAATCCATCCGGCGCCTTTTCATGGGTAGGCGATGTGGTTTCCGCAAAGCCGCGCGTTGCGCTGTTCAATGAAAAATGAGAGTAAATTTAGGACTTGTTGATTAGGATTCCGGCGATGCCTTGGATAAATCTTTAAGCATAATGTGCGTGTAAGTCACGGGGCACAACAGCATCCGCTTCCTTTGCCATCT TCAGTTGCTGGCTTCATTTGCAATTTATGAAGGAAGCACTTACGTCGACCTGGCACACATGTATGTACATTGTATACTGCACATTCTCACCTCAGGCTAACACGACGGACCCACTTCTTAAACATGGTGGTTGGTTTCAGGCGCTGATGCGGGCCGTATGCGTTACTGCACTCCCAGCGTCTGCATAATTTCGGACATAAAACGGAAGCTACCGAATCGAAACGTAGACAAAAGCCGCCGAATAGTCTACGCTATGTACTGGACAATAAAAAAACCATCAAACGGAGAGCCGAGGGGGGCCACTTGCACCCAAAGGAGCTCTTTGACACTGCGAGGCGATGACGAACGAAACTAGAACTGACAGGCATACACAAAGGCGACTTTAGCTACGACTAGGCCGAAGGATGTCGATGACGAAGCGAGTCGCCGACGACAAAGCGTTGTCAGCTGTGCCAACAAAGCTTCGAAGGGAGCCCGTTGAGGCGGAGGAGAAGGTTTTGTATTTATTATTTACACGCGACTTGGCAGAAATTACAGGCTGCCCCGAAACTACGACTGCGACGAACTTCGGGCATTGCATTTTGCATGCGCTGCTTAGGCGCATGCGCCTTTCCAAAGGAGAAGGAGGAGTAGCAAAGCCGAAGCGGGGGGTTCCGGACTGTGGGCAATGAATGCGTAATATTAGCACGCAGCACACATCACACATAACATAGCACGCTTGCCGGCTGCCGCATCGCATCTGATTGATGGCCAGTCGGCGCACTTGGTCAAGGGCATGTCTTAGTTGCTACTTGTAAGACCTGCACAAGTGGTCTACTTACCAGCCAATCGGGGAGCTGCCAATGCTGGTGAAGGGATCGTCGTAGGCATCGTAGAAGTCCTCCTCGCCCTCGCTGCTCGAGTATGAGGTCGCTGGCACAATTAAACCCAAAGGAGCGGTGGTGGCTGCCAAGATTAATGCCAGATTATCGGGGGTAATGCAAATTGAGCTTTCGCATTGATTTCGAACCGCTTGACCCT


Search Again