CR00887

CRIMIC CR00887

Gene CG5168

CG5168

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79344

Images

Construct Sequences

sgRNA sequence
GGGGGAAGGGGGTGCGACAGTGG

Amplicon 5' Amplicon 3'
GTAGGCGTACCATCGGACTGGATCCACCTTAAATAATATGGCTGCCGAGATAAAACCAGCTCAGCGGACCAACAATGATCGCTTTAACACCTCCAAAAAGCCGGAATTGCTGAGTAAGCTGGAGGGCAGCAGCGACGATGTGAACGCAGCGATCCTAATTCCGGGCGAAAACGGCGTAATTAGCGTTTCCGATGACAAGTGCGTAGCTGTAGCCCATTAAAAATATACACAAATGGTATGCCTGACATTTTCATGTTTTCCCCAATAGAACCGTTCGCGTTTGGCTAAAACGCGATTCTGGTCAATATTGGCCTAGCATTTGCCAGTATATGCCTTCCGGCTGCACGGCCATCGAGTACGTTTCGGAATCCCGGCACCTGTACGTCGGCCAGGAAAACGGAACGGTCACCCAGTACGCGCTATCCGAAGACTGCAATCGCCTGTCCTTCCTGCGGGATTACTTGTCCCATCAAGCGCGGGTCATGGCCGTGGTCTTCTCGAAAACCCACAAGTGGATACTCTCCGCCGGCAAAGATAAGCAGTTCGCCTATCATTGCACGGAGAGCGGCAAACGGGTGGGCGGATACAACTTTGAGACACCATGCACGGCTCTCCAGTAAGTATGATAAATGGATGGTGAAAGGGGGAAGGG GGATATGGGATAAGCGGGTCATTTAATTGGATTAAACTGCTTTCTTTGACACGGCAATAAACTGCAATTCTTCACGGCTATGGAATTCATTTAGAATTTGAGAACCTTCTATTGTTAATGACGTGTCAACTGAGTCATTTTATCTACACAAAATTTTGGCATAAATGTGTGCACTGTGCGAAATATTCTATAAGCAACATATAATTAATTATAATCTGCGTTTAGGTTCGACGCTTTGGCCAAGTATGCCTTTGTGGGCGATCATGCTGGACAGATAACAATGCTAAGGTGCGATGTTCAGGGAGTGCAACTAATTACCACTTTCAATGGACATTCGGGTAAACAAGTTACAAATGATATTTAGTAAGCTAATTATATACGAATTGGTTAATTTTTAGCGGAAATCCGGTGCCTCAAATGGGTGGAAGGCCCTCAGCTCTTGTTTAGCGGAGCTTGCGATCAGTCCGTGCTAGTTTGGGATGTTGGTGGCAAACGTGGCACCATTTACGAGCTGCAGGGACATAGGTATCTCCAATCTTAAATAATATTCATAAAATAAGATAGTAATCGGCACTTCTGATTATGTAGCAACAAAGTTTCCGCCCTGTCGTACGCGAATCACACGCAACAACTGATAAGCTGTGGCGAAGATTCAGTAGTGGTTTTTTGGGAAATGAATGCAATGCGGAAAGAGGTTCCTGGCTGGGTGGATACCAACAACTGTCAGCTTTGCTCCAGGCCCTTCTTCTGGAACTTCCGCTCAATGATGGATCAAAAGCAGCTGGGTGAGATAAATAGCTTACACTTGAGTTACTCTTTGTTTTACAAGTAATTTCTGACTGTCAGGAATACGACAGCATCATTGTCGCCACTGCGGCAAAGCCGTGTGCGACAACTGTTCCAC


Search Again