CR00886

CRIMIC CR00886

Gene qkr58E-1

CG3613

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79343

Images

Construct Sequences

sgRNA sequence
AAAAAGTAAGGGATTAAAGGAGG

Amplicon 5' Amplicon 3'
CGATGATGAACGACCGTTGCTTGGTTTTGCTATTTTGAAAAGAATTTTATTTGTTGTTTAGACTTTAAATTGTTTCTTGTTCTGTCTCTGTGGTGCTGTTTTTTGGTTTTTGGTTTTTCTTTTGCTTAGCATATATACATTGTAAAAAAAAGAAAAATATATTGTTTAACCGGTTTTGAATGCACTACACCCTACGAAACGTTATTGTTTTGAGTAAAATGCATTTCGTTTCATCACGTTTCAAAAAAAGTTGTTCCACAAACCTTTCAGCTTGGATTTTATAGTTTAAGCATGTTCAAATATTTTTGGGTTTCTTGCCATGAAGTTTTATGGTTTTGTTTTCAAAGTGTGAATTTCAGTAATTTGATTGTTTGATCGATTGTTTTAATATTTTGGCTCTGGCTTCTTGTGAGTATGTTAGTAGTCGTCCAATTAATGAAGATGATTTACTGGTTGCTGTTCGGTTTAGTTGATTTGGCCTCTGTTCAGGCATAGTGCATTTAAAATCTTGTTAAAATGGGATGGGTTGCCGTTTTAATAATTTTGGTACGCGGCCTTGTTTCTTTTTCTTTTTTGGTTTCTGTTTTTTTCTGCGTTTTCAATTTATCGGCGCTTAGTTGGATAGATTTTGTTTTGTTTTCGAGTTTTTTTTTTGTTTTGATTTGCGCGAGTTAAGTTTAAACGTTTACATTGCTATTTGTCGTATTCTTTTTCTTTTCTTCATTTTGTTTATTTTTACATGCCTGCTGAGGGGAAGAGATTATTGGTCTAGAAATCTAGGTATCTTACCTGGATAGGCCGCCGCGTAGGAAGAGGAGGACGAGTGGGGGTGATACTCACGCCGATAGTCGCGCTCGTAGGAGCTACTGTCATACTGGGCGTGGTGGGTCGAGTGCTTTGATGTTTGGGGCGGCGGTGTGGCATAGCGATCATATTCTCCATGGTGGTCATATAGCTCGTGGTCCCGTGATCTGTTGA GGAGGGTTTTCTAACAATGGTTGATAACACAGATGCACGCTATTGAAAGCATAAGAATTTAACTTCTAAAGGCATCATTAACGCGATTGAACTTAGCTAACCTGTGCGTCTTTACGATCCCATAGTTGGGATCGTCCATCACATATCGAGCCTTCTCCAGAATCGAATAGACTTTGGGCTTTGAAGAAGCAGGGGGCGGGGTGCTGTGACGAAAGGAATTCCTTAGTAACCAATTAAAATTCAACGAAAATTGACAAGCCTACCGGGAACTGTAGGCGCCATGATCGCCATAGGATTTGGAATAGTGGTGAGACTTCTTGTACATGCGCTCCTTGCCATCCATCTCGCGTAGTTGCTCCAACCGAATGTCGTCGTTGGCGTCGGGTATCATAAACTTGCGGATCTCGCCTAGCGCATAGCTGATCCTGTGATAGGCCTCCGCTGGAGGGGCCACCGTGGATATCTCCACGTGCAAATCGCGGCTGAGATGGGCGTACTTTGGATTTCCGGAGCTGCGAAGCTCCTCCTCCTTACCGTGGTCGCGCATCGAGTTGCGCCCCATAACCACCATTTTGCACATAGTCTCTTCCTGCAGCTGCCGCAGTGTGTTGCCCTTGGGCCCCAGGATCTTGCCAACGAAATTGAACTTGGGGTACTCCTTGATGGGGAACAAGACTTTCTGGGCCACGCGGATGGGCTTTTCGCTGTACACGTTGGCATATATCTCGGGCTTTGGTATGCGTCCGCTGACCAAGATCTTCTCCACCTCTGCGGGGCCATGAAAAATTGCAATTAGATCCACTATAGCTTACATGTCGCAGCGCCTAACTCACCGTCGTCAAGTAAGCGCTTGGTGATGATGTGCTTCTTCTCGAGCGTCTTCTTTTCCAGCAGGCACTCCTGCAGATACGCGTTGGTCTT


Search Again