CR00885

CRIMIC CR00885

Gene CG1371

CG1371

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79342

Images

Construct Sequences

sgRNA sequence
TTATCAGGTCATCCCAGAAAGGG

Amplicon 5' Amplicon 3'
CAGCTCAGGACTCAAGTGCAGCTTCAACTTGGAATCTAGGTTGATAGCTTGCAACAGGTACTTTCCAGATGGCACGTTCTTGAAAATATACTCTCCCGATTTGTCCAACTGGGAGAAGCAGGAGGATGCGGATTCGTATGCGCTATTAACACTATTAGGCGGCGCTGGGGAGGATGTCTCACATTTTGGCACTAAAGATTGCTAAAAAGAGAATAATGATAAACGTTAATAATTAATTAAGTTAACAACTTAATTTAATTTATGTAAAGTGTATACAGCAGTTTTAAATAAATTAAACAATTTTTGTGTTCTTTCTTTTCAGAAAATGTGTTAGAAAATAACTATACTTACTCCTTTCTTCTTGTAAAGAGCCACACCCAGATTTCCAGGAAGCGGCGAGCTGGAATCAAAGCGACCAACCACATCGAATCCTGAGACTACCAAAGAGTTCGCCGGCAGCTCGGTGTTGCCGCTAACCACAACCACCTTGTGCTCCGCCTTGGAGAAGTGCCACCTTGCGTGCGATGCCTTGACCACGTAGTTACCGGGAATAATGGGCGTAAATGAGAACACTCCGTTCGCATCGCTCTTTGTGCGCCGGACTTCGCCCTGTTCAGATCGCAGCTCCACGTCTACGCCTCGGGCACCGCCGCCGGCGGCGAGAGCCACCTGACCGGTGATGCCAAAGCCCTTGAACACAAAGTTCACATCGCGACCCTGGCTGCAAACGTCGGTCTTGCCATCGAAGTTCAACTCCACCTGTTCCGGCTCGAAGCTCCAACCCGGTGGCGGAGAAATGCTGAGCAGGTAGTCGCCCTTATCATAAATCGGCAGGAAGTAATATCCGTTAGAGGGTGAGCAGTCCGTCTTGTCCTTCAGGGATCCCTGCTTGGTCAGCCTGCAGAGCGAGATGGAATTAGGTTAATCACATACGGGCCAGTTAATTTATTATTCAATTAGCGGCCACCATGCGCCACAATTC CAGTTTGATCTCCACCCGGGAAAAGTCAATCTCGGCGTGGCTCTTGATGAATCCACCGCAGCCGACGACTTCCACCTCGCCGGCGTTGGCATTTTGGAAAAGTTTAATTAATAAAATTACGAAAACGCCGGAAAAAAACCTCATTTTGACTACGTGCCCAGAGTGACCAGGGCTGCACCTTACAAATACGGGCAACAGTGTGGCCGTTCGTTAATGTACACACTCAGTTTGCGATAGTTACCATATAACTATAAAAATTTGAGTATTTAAAATACTGCATCCGTTAAAATAACGGTTTCAAAAGCCTTAGTATCGTTTTTATTAAATTTAAATGCACGTTACTTTTGATAAATAATACATAGCTTGCAATTTAATTAAAAATCTACAATAGTATTATTAATATTCAATATTCAAAATATTGTAGATCAGTTTGCTTTATTTATGTTTGGTTTTTCAATTTACTTTATAAACTTATATATTTTTGACAAGCAACAATACCCTTACATTTTCGATGATCAGATATAAATATTTTGAATGTTACCTCTTCACTTCATATTTCATTTTATTATATCTTTGAAGGAATCTTAACTGAGTTATCGTTAAGGATGGGCCATAAAAGAAGTGCGATAAAGTGAATACAATTATTATTAAGCGCTCGCCATTTGGCATCGACATTGAACACACTCGTCTGCTGAAACAGATAATGGCTTGTCGTATATTAATAATCGGAACCAATTTCCATCACCCCAATGCAAGATAAAGACTCACACCCGAATATACGTACATTTGTATCTATGTTTGTACATGGATGAGTGTGCGAATCAATCCACAGTAAACCGATCTGAGGCCTCAGGCCCCGAGATATTGCTGCAAAGAAATTCATTTCAAGCGTCGTTGGCGCTATTGCGGCGCATGTCTAATAAATATCATCGCCGATCGCGCGATAAACGACTAGCACATAAGGAATCCACAGTACGGTATATATGGGTCCGAACTCCCCAGTCTGAT


Search Again