CR00882

CRIMIC CR00882

Gene Prosalpha7

CG1519

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79341

Images

Construct Sequences

sgRNA sequence
GGCTTTATCCTAGTTCCGAGTGG

Amplicon 5' Amplicon 3'
TCCAGTCGTGCGTCGTTAAAACCAAAATAAAGTACAACAAATGGCGCGAAATGCATCAGCTGTGAGCGATAAGGTTTTTCTTTGTAGCAATCGAGGTTTAATAGCTGCAGGCACATTCAAAAGGAACCAGATCCGATAACCAGCGAGCCAATATATTTATATCGAACGATAACTATTAAAGAATGAGAGTATAAAAATATAAAAACCTTAAATTTCACCCGATTTTGTTTATTCATTTTGCGCTTTAGGGAAATATAAAATTAACATTATGTATGAGGCCCAGAATTAGATTCACTGGCACACAAACGAACTAGTGCGTCTCATTGTCGCTGTCTTCGTCCTTGTTGGCCGCATCGCCGGCTTTCCTCGCCTTCTCCGTCAGTTCTGAGGGATTTATGAGATGTAGGCCACCGGTTACCCTGCCCACCAAACCCATTTCGAAGCGGAAGTCCTTGTCCTTCAACTCGTCATGGACTTTGTAGATGCTAAGACATAGGATAGATATGTTAATTATGAATAAAAACCTAGATTCTAAGTGCAATAGATGTCCCAAAAATGCTTCCTATTGTCAGAGCAAGTAAGTTTCCACTCGGAACTAGGATAAAGCCCGC AACTAGGATAAAGCCCGCCCGATTTTTGAAACAGTCCCTTTTTTTTGCTGTAAACGTACATTTCACCAGCGCTCTCCACCAATTCGTCGGTCCTCATATCCATCTTGAGCTTCTCCATCTCAGTCTTGGCCAGCTGCTTGGCCTTGCCGCTGGCGCAGGCGAAGTAACCGAAGGAGGAGCCGGACGGCTCGATCTTGTAGAGCTGTGGCCCCTCTACTTCGTCCCAGGAGGCGAGAATGATGGAAAGTCCGAAGGGGCGGACGGCACTGTACAGAGTGTAGGCGTGAACGTAGCCGGCGACTCGGTGGCACAGGTGTTTAAGCGGGATAGCCTGCTCAAATTGCTGTCTGTAGTTGGCTGCCTCCTGACGCGCAATGTCAGCCACAAAGTTTCCATCGGCCACCAAGCCGGCCACCGCCATTCCGATGTTCTTTTCGATGGTGAAGATGCGTCCGCCGGCGTCTGGTTCGTACAGTTTACTGGTGATGATCTTCTCCACGGCCAGCACCACGGCGTCCTTGCCCCGAATCCCGATTACGGTGCCGCTCTTCTCCACCGCCTTTGAGGCGTAGTCGATCTGGAAAACGCGGCCATCAGGCGAAAACTGCGAGGCCGACAAGTCGTACTGGAAGCGAGAGGGTGACGTTAGGGATCTGCAGATATGTAGTTCGCTGACCACTTACTCCAGTGCCAATAGTACTCATAGCGAAGACTTTGTGAAAATTTAAACAATTCAAACGCAAAAATTAGTTTAATTCCTTGGGTCGAATGCGACGATGATTTGACGGCTTTTACTTGGCTAGTGGTGGACAAAACAAAGGGGC


Search Again