CR00881

CRIMIC CR00881

Gene PRL-1

CG4993

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK81151

Images

Construct Sequences

sgRNA sequence
GAGATTATCTGTGCCTGTTAGGG

Amplicon 5' Amplicon 3'
TTAATGGGGTATTCGGGCCGTTCATAATTAAATATATGCGTATAAGTCTGTTTATATATGCTGTAGGTACAAAATTAAATTGTTTTTTTTTTAGCTCGCTATGGGGTGGCTGAATCGAATTGTAAAATAACAATAAATTACATTAATTAATACATACAAATTTTACACAACTGTTGCCAATACATTTCAATGTGAGATTTGAGGTTTAGTAATAACTGGGGCTGTAACTCAATTTCTCCTTCCATATTTTTGGGCTCTCTGTGGTTAGTTCAATTTTACGGATTGCTGCCTATCAATTCATATTTGTGTATGCGCTTTTCTATCCGCTTGCATTTTTTTTTTTTGTTTTTGAAAAAATGAACACTTTTTGTCTGGTGGGAATATACATATGGTGTTGGAAATCTATTGCACAGAACATGAATTCTTATGACCATTTTTGTGCTTTAGTCTCGCCTTTGGCTTGTATTTTTCCAAAAAGGACAGCTGCTTGGCATTAATGGCTCCGCGTCGTTTACTAAAACAAATTGCATGTTTAATTAATTTTTTTCATCTTGTCGGCTTGTTATCATCAAACACTTACTCTCTAATCATTTCCACTGCTGCCTCATATTTTAAGCCCAATTCAATCAGTGCCAAGGCAACAAGGACAGGAGCTCGTCCCAGACCAGCCACACAATGAACGGCAACGCAAGCCTCCGGATTTTGTTGATATCTGTAAAGTACAACAAAAAAGTTATTAAGTTTATTACAAAATAAATACAAAGGCTTACTTTAATTATTCAATTGCTTTAATTTTGGTCTAAGCCTATAACTCTAGGTCTACACGCTTACCGACAAGTTTCATTATCAAGAAATGCAGTATTATTATAAATTGCTGATGCTGCCTCGCCAGTATCATTGA GTGTCCCGACCTGATGCTGCGGATAAACTGGCTCTGGTTGCTGAAGTTCTTATTGCAGTTGCAGTTGCTGTTGTTGGTGGAACTGTTTTTGGTATGTGTCTGAGCGAGAATCGCTTATGTTTGTAGTAGGATAGTGTGGCGCTTGTGGACTTTCTAAAACTAGGGCACAGCAGCAGCGGTATCATAAAATAGCACACGAAACGAATCATATAGGAAGGTAAGGTAAGTTCTCGTTGATCAAGTTTGGTAGCTTACAGGTAGTACAAGTTGTTGATGGAGTGCGGAATTCGAAATTTACAAAACGAAAACGTTGAGAGAGAATTATGAAGGAAGGATGGTGCAGAAGATTTTAGTTAACCAAATTCTATACAGCAACTTATAACTGATGAAATCATACTAAGCTAGCAGCTAAGGCGATAGCGGGGACTACAAGCGGGGTTCTGTACAACTTCGAAATGTTCTTTTTTTTTTAATTTGTGCTGAATTTTTAAACAGCTCATTGGATATGTGGCTAGCGCAGCTTTTAGATATTTGTCTTTGGTTTTTTTATTCTTTATTTAGTAATATTTGATTATCTTTGGATTGAGTGGCACAAAGCAACAAATAATACTGAATAAATTGATAAAAATCACTTGAGGTTTTTTATTTTGTAGACGCGTTTAGTTCGATTGTGGTTTATGATATCTCGGAAATTATGTTAAGTAAAATAATACATTTAATACATATGTCTTAAATAAGAACTATTTGATATGGTGGTAGCTGTAAATTTATCAATCTAATTCGCTTATGAAATAAATGATAATATCTTTACAGTGTAGCTATAATAATGTTGTTACTATTTATATTCAATGTTAAAACTAATAATGACTAAATTTATTAGATCTCCAGTTTTTGAATGTGAAACAAAGTAAAATAATACGCTCAGTGTCTTAAATGACATAATTATTAAAATAACAATTAACTACGCGAATGCAAGAGCTCTGTTATTGTACTCACTTATCCTTTAAGACCTCAAACCACTCGTCAACGACTTGCTGAGGCGGGAAGGTGCCGTCCTCAAAGGCCAGGTCCTTGACGGTAATGCCTTGTGTCTCGAGCTC


Search Again