CR00880

CRIMIC CR00880

Gene CG8613

CG8613

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79340

Images

Construct Sequences

sgRNA sequence
ACTGAGAATTCGAAGTGCGTGGG

Amplicon 5' Amplicon 3'
ATCGGCCGCATAGGTGTAAGCATTTTCTACATAATTATCAAAGCAAAGATATACCGTATGCATTAATAAAAGTATGAAAAATATTAAGCTGCACATTTTGAATTGAGCTGATTATTGGGGGAACAGCCTGAAAGTAGGCTACAAAACTCTTGTCTTCAGTACTCTTTATCGTGATTCCCACGACGACTTTCTTGCTTTTACATCATAAACTCAATGTGGTAATAAATTTAAAAATAGTTATACTTTTCTGTCATATTCACCAAAAGCTGGAAATTTGTATTAATTTTAATGTTGATATGAGGTCAAACGCATAAAATAAATGTATAAAAGATGTTTTGCTTACTCCGAAATCAAGTCTCAAAAATAAACCCTTGAAATATTAGTTTGAAATCGGAATTTTTTTAAGTAAAAAATAAGTTCACAACAGTTAGTTTAAATTCAAAACAATCGATAAGTGCTCTGAAAAATCGGTTTCGCTGGAAATTGACCATCCGATGGTATCGAATAACATCGCATTCGGTGCCAGCCCTATGCCGATAAGCTAAACAATATTAAAAACATTGGTCAATTCGCGTCGATTGCACACGTTGCACTTTTGTTGGCATTGGACGAGGTCGAGTGAAAGCACAGCGCAAGCCCCGAGAATCCCGATTCGTTTGCTATGTTCAGGGTCAGGCCGCTCCTCCCCAGGATACGAAGCTCCCTGCAAACGACCTTGAAACTCCAAGCAGATACATCGCAATCCGAATCCGAATCGTTCCGTCGGAACCTACGACTCCTACACAACAGTTGTCGTAGTCGCCCTGTGAGCAAGTAAGTCTTGTGCGTCCTATCAACCACCTGTTTTGATATCATTTTTGTGCGCGCAACGCAGCCAGAAATTCCGCACAATGGCCACCGGAGGAGAAGCATCCAAGGAAGTGTCCAAAGAGGAACCCGCCAAGCAGGGCAATCGCTTGGTTGCCTCGAAGTCGCCATATCTCTTGCAGCATGCCTACAATCCAGTGGACTGGTGAGTAGCAA GCGTGGGTGTTATTCCGTCTTAAATCACGTGTGATAAGAGATAAGGTTGATAAACAGCACAAACACTTGGGGAATGGTAATGAAAACAATAATATAGGCTTGTTTATAACTGGTTGGGTTACTTTTGATTTACATTTTAAATTACTTACTGATAAGTCGCGTCTCTTGGTTATTATATAAACTTGTTATGTGGTCGTAATCTAAATATATATCGACTATTTTAAATTGCCATTTGACCCGTTGTTACAGGTACCCGTGGGGCGAGGAGGCTTTCGAGAAGGCCCGCAGCGAGAACAAAATCATCTTCTTGTCAGTGGGCTACTCCACCTGTCACTGGTGCCATGTAATGGAGCACGAATCGTTTGAGAACCCGGAAACGGCTGCGATTATGAACGAAAACTTTGTAAACATCAAGGTGGATCGGGAAGAGCGACCGGACATCGATAAGATATACATGCAGTTCCTACTGATGTCCAAGGGCAGTGGTGGTTGGCCGATGAGTGTGTGGTTAACACCCACTTTGGCTCCACTAGTGGCGGGAACTTACTTCCCACCCAAATCCCGCTATGGAATGCCCTCAT


Search Again