CR00879

CRIMIC CR00879

Gene CG9934

CG9934

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79339

Images

Construct Sequences

sgRNA sequence
CGTGCTGGGTTACCACAATGAGG

Amplicon 5' Amplicon 3'
TCCTTGAACTCATCGGGTGCGTCGGCGCATTCATCTTCAGTCTGTAGGTTGGTAACTGCAAGGGAAACGTTTGCATTTGCATTTCAATCCGATTTATTTAGTTGTTTCTTAAGTTCTTACCATAGATTTCGTGAGCTCTCTGTGTGAGCGCCTTGAATCGCTCTACCTCTACCGCCGATCGGAGGGCCAGTCGCTTTATCCTCGATGCTGCCTCATTGCAGATTTGAACGTCGAAGGAGCGCTCGTCGGCAGCCAGGGCCTCAGCGAATCTATCACAGTCCAGGTGGAGATATATGTCGAAGATCTGGGCCAGCAGACTGCGTGGCTCCCAGCCGTATTTTGCCGGGTTCTTGACCTTCAGGTCGTTGCACTTGGGCCCGGCCAGCTGTTTCAGATTGAAATTCAGCATGGAGCTCAGTCGATCTACGAGCTCGTCGCGCATGAACGGCTCCTTAATGTCGCTCTAAAATTGATAATAGGTTTAAATTTAATAAGCACTCTCCACACTCTATCTCCACTCACTGTCAGATAGTGAAACAGATCGACTGTCTCGCGAGCCAAGGTCAAGTAGGAGCGACACTGGCGCTCGTCCGTCGCCAGCTGAGTAAGTCGGCTCTGCTGCTGCTCCGCGCTCATCTTGCTGAGATTGGCCTTATCTGATAGCAGCTGCTGGGTCTGATGTATGCGCTTCAGGTTCTCCAAGCACTCGTCCAGCAAAAAGGTGGTGTCGTTCATCAGCATATTGACAAACTTTACGAACTGATTTCCCACCCGGGATTCACAAATAACGGCCTGCCGGTGGATGGGGTTCTCCCACATGGACTTGAACAGATGGCTAATATGATATCTGTACAGGAATAATATTTGATTAATTACACGTGTTTGTAAATCATACATTAAGCGTATTAGTATGAAATACGAATATGTATATATTCATGTTTGTATTGCCCAGATCATTTAGCTGTATATAAAAGAGTGTTTATCTACGCCTCAAATAACTTTTGGAACTTTTCCGTGCTGGGTTACCA CGTAACCGCCGTTATGACTCATTCTAAATTATGAAGGTAGCTCGGTTGGCATGCTCACCTAATGGTAAACTTATCGTAAAACTCAGTGCTTTGGCCCGTTGTCTCTACGTCCACATAGAATCTCATCAGTGAGCTGACCAGGGCGTTCTGGGCCAACTCATGGTTCCACATCTGTTTGGAGCACACAAACAAAGCTTTAGAAGTATGACACTTAGGCGATTGTAACCGGAACCTACCGCCGCGTTAACCGAGTTGGCTGGCTTCAAGGAGAACACAAACATCACCTCAACCAGTTTGGCAGTCACATATGGATTCTTGATGAGGTGCGATGCGCAGACGCAGGTCAGCAGCCAGGTGATGATCGAGTGGTCGATGCCCTGACGGATGTCCATGTTGGCATGCTGCATGGTGAACAGGATGAACTCAGCGATGTCATCGATGTACCACTCGGGCAGTGCGGAAAATGCATCCGTTGGTAATAGCTGCTGCACGGGCAGTTTGGAGATGAAGGGTCCCTCGATCGGGCGTCCCTCGAACTGGTATAGCATGAACTCGCAGACAGTAGAGTAGAATTCCGTGCAGCGCTGGAGCAGGCCCGGATCCAAAAGAGTGATCTCGCAGCAGGTTTTTGATCTAAAATTCGGAAGGGATACCAAATTAGATTCAAAGATGTGTCACACTTAAGTGGAAGTGACTCACTAAACGTGTGAAGGTCACAAAATGATGAAATGATTTTAAATAACCCACCGATTTAGCTTTCGCAGTTGCTTTTCCCAGCGTTCCTTAAACTGATTATTACGATTGGCGTAGCGGGAGTTCATCCAATGGGACTTGGTACGGTCCAGTTCGTCGATGAGTTTCTGCAGCTCTTTAATGGCGCGCACCTTTTGGCGATAGCGCTGGATGGCAGGCAGGTAGCCCAGATGATGGGCCTGTAGGGTGAGGAACCAACACTGCGTCTGGAAGTTTGTGTTCTCCACGGGCTGGCTAAAATCACGGGCCAGGAAGTTGCGGTACTCCTCCTCGCTGTACCTAATCTTCGTGTCCTGCTCGATGTTAACGAGCGAGTTCTTGTAGTAATGGAAATTTGGCTCAATGCGGTCCAACTTGATCTTCACCGACAGCTGCTGCAGCACGCTCATCAGGTTAATCATAAAACCGTCCCTGGCCAG


Search Again