CR00878

CRIMIC CR00878

Gene Fpps

CG12389

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79338

Images

Construct Sequences

sgRNA sequence
CATTTCGACCGGTATGGGCATGG

Amplicon 5' Amplicon 3'
ATCCTGGGTGGGCACTAGATTCTTATACGTGAGCACGGTGAGGATGCCGCGGTTCTTCTTGCCCCTGGGCACATTGTACTGGAGGACTTGGGCGAACCATTTGGCTGCGTCGCTGCAATTGTATGCCTTCGTCACGGTGGTGATGTCACGCACAAGATCTGCACATCGAAATATAATTAGCATTAGTATTTGCATGATAATTGTTACTGGGCATAAATAAACAAATCTCACCTGGGAACACGGCCATAAAGTCGCGACTCTCATCTTTCGACACCGTGACGCGAGCGGCAATGGGAACCGAGTGATTTTGGAGCGTCGATAAGGTTCTGTGGACAAAACAAAAGTCAAGAACAATAGAGCCCATAACTGACACCACCAGGCAGGCACAAATACATACACACACACATGCACGCATCTATGGTCTACGTGACTGCATAAGCGGCTCGATACAAACTTTCTCCCCCACTTGAAATCAAGAAAAAAAGACCCCGAAACTCCTTTTCGAAAATCACGCCCAAAACAGGCCTCCGATACATGCAT ACAAAACAAACAGGCAAGGCAAAGGTCAAGTGCGAAAACCGGTAGATTGATTACCTGCTAGTCTTCTTCAGCTTCTGTTCGTTGACCAGTTCGGTGGGGAGGCCGCCAATGGTGTCCATGGACTTGATGATGGGCTCTGCGTTGACCTCGTCGCTGGTAGAGATCAGGCGTTGCAGGCGCAGCGGGCTGGCCAGGATCCGCTGCTGCGGCAGGAGCATACGGGCCAGTTTAAACATTTTTATTTAAGATTATCGGCAGGTAACTATCCGCTTCACAAAACGGCAATTCAACTTCGGGTACCAAATTGCCAGTGTGACTGAATCTCGGTTCGCAAAAGAACCCACCTTAAAATTTCAAATAACCATAATACGTTTATAGCAACTATTTTATAGCTGACTTTTATTTTTCGAGAATTTTGTGAAGGTAACTTATAAGTTAAATTTTTAAACATTTTTATTTAGTAAATTCAGGAACAGCAAATGATTTACTTTTGCTGAAATTATTAATTTTATTGCGTGTTAATTAATTAAATGCATTACTATATATAAATCAAAATGCTGACGAATTTAAACATGATGCAAATTGTCGAATATATTTCGATATCAATATCTTCAAATTATATTTGACACTCTGCTGCTACATTTTCGGTCACACTGTTTCGATGTCCCATGAACAGTGTTGGAAATGGCCTGACATACACCAAAGGCAAATTGGCAGCTGAAAACACGAATTAAACTAAAATGATGGATGAGCAGCTAATTGACGAGGTAGCGCAGCACGGAGTGATCTACAACCGGCAGAAGTACTACCTCAACGGCGGCGCCAATGGTGGCAAGTACGAGACGAAGGACGAGGCCTGGCAGCTGATTGCGATGAAGCTGCGCACGGATGGTGAGGAAGACGCGCTCCTCCGGCAGATCCTCTATATAAATGTTGCCCTCCTTTCCAGTGGACAC


Search Again