CR00877

CRIMIC CR00877

Gene Tehao

CG7121

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79337

Images

Construct Sequences

sgRNA sequence
GAAGTACCGAGTTCCAAGTGGGG

Amplicon 5' Amplicon 3'
TTCGCCTTATCGCTGTGGTTGCGGCTGCTGCTATTTCCCTTATCAATACCCGGGGCACGAGTAATGGCTCATCGAGAGTTCCATGTCTCCCCCTGACAGGCAAGTGGGGTTATCGGGTCCTATCGTTCAGATACTAATTGCAGTGTTATTATTGTACACAGATTGGCGCCAAAAAGTATGCCAAACATTATTAATTGATTGATCCTTATCTGGCTGTAGTAATTCGTGCTCAAATCAGACAAAATATTTCGTATTTGTTACGCCACAAGTACTACTATGTATATCTAAACAATTCATTATGAAAAGTCATATGAAACGTAAGACGTATTTTATTTTTTTTGTATAGTTCTTGTCTATGGCAATCTTATTGTCGTTTGATAAGATGTGGTCGAATAGAAATTAATTAGATATTTTTGTGGCTGATAGATTTTAATTATAGAAAAAAAGGTTAAGCTTTTTACCGATCTTAAAAAATGGCATTGAACAATGTTCTTAATACTATTGAGATTTACAATCAATCTGCGCGAAACAAAACTTTTTATACTGATTTTCTAGAAACCTAAGCATTATCATGTTGATTTGCAGAATTTATTTGTAGTCCCCATTTTGAATTAGCAATACCATAGAAGTTTTTTTTTATTAATTTAATAAAAGTAGCAAATTGGTTTTTAGATGTCGCAGACATAAGCATTATGCTTAACATAATGCCTACTAATCCCCTCATAAATGTTTTTAAAGGCTTCACCACTTATAAAATACTGTTTATAAATCATTTTTATATTGTTAAATAAATATGTAAGTAACATGTAAAAATTATAAATAAGCTAGTTAAAATAGCTTTACCATTTTCGATAGCTTATTTAAAAGAATCAATGTTATTGTATAGCATTAGGTCACTAGTTTTGGGATGTAGATAACGATAGCCCCACTTGGAAC TGGAACTCGGTACTTCCTGATTAATGTCAATCTAATCCCTCTGAGATCTCCTCCTCCTGCAGCACAATTTTCGCACCATTGACTTCGCTGAACGTTTTGCGTCTGAACAAGAACTCGCTGACCGCGATGTCGCCGAGTGTGTTCCAAGATGTGGTCAGTCTGAACTACATCGAGATGGTGAACACCCAGTTCTATGGGGCCACGCTCCTGATGAACTACGAGGCTGTGGTGTGCACCAATGACGAGGCGTGCCAGTACAAGTCGGCGGAGTGGCAGTGCGATCCCCGATGCATCTGCTGGGTGCAGCGGAGTGTAGGTAGTCTGATCGTGGATTGCCGCGGAACGAGTCTCGAGGAACTTCCGGATTTGCCCCGCACCACGTTACTGAGCACGGTGCTCAAGGTGGGCAACAATAGCCTCACCAGTCTACCCACTGTGAGCGAACACAGTGGTTATGCCAATGTGAGTGGACTCTTTCTGTCGGACAATAACCTGACCAGCCTTGGAAGCGGTGACCAGCTGCCCGATAATCTCACCCACCTGGATGTGCGAGGCAATCAGATTCAGTCACTCAGCGATGAGTTCCTATTGTTTCTTCAGGAGCCGAACAACACTATGACGCTATCGTTGTCGGGAAACCCCATCACCTGTGGCTGCGAATCCTTGTCGCTTCTCTTCTTTGTGCGGACCAATCCGCAGCGGGTACGGGACATCGCCGATATTGTGTGCACCAAGCAGAAAAAGTCCTTCCAGCAGATGGAGGCCTTTGAGCTGTGTCCATCGTATGTCCTACTCATCAGCTGTGTGGTCGGTGGCCTGGTGATCGTCATCTGTCTGCTCACCGTGTTCT


Search Again