CR00875

CRIMIC CR00875

Gene tun

CG8253

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79336

Images

Construct Sequences

sgRNA sequence
TCGGTCCCCCGATGAATTGGCGG

Amplicon 5' Amplicon 3'
AAGCGAACTTAGTGCCCGATGCAAATGATACCCGCTGCCTTGCCCACTTGTGTGAATGATTATCTCATGCCTGGCCAGTCCCGGCGGACGAGCGTTTCTTCTTTTAATTATGTATATTTTATTTTTGTGCGTTATCTCTTTTGGCAACAACATTCGCCGCTCGGCGCTGCCATGTCCTTCGTCCTGTGCCGCCTCCTTTTCGGATGGTTTTCATTATCCCATCGCTTATTTGGTGGCTCCACCTCCTCCTCGTTCGTCGGCGTGCCCCGCTTTGCATTCAAATTCGCTCATTACCCACTCACTCCTGTGTGTCCTGCGACTCCGCATCCTTGCGCCGCCTCCCTTCCACCACTGGCTTCCCGAATTCGAATTCTGCTTCTGAGAATCCTGATGCGGCGCCGTTTGGCGCTGCGCAGCTCTAGAAATTAGGTCAAACGGTCATGTCTGCCAACAAGAAAAGCGTGCCACTGTGTTGGTGGTCGCTGTATCTGTGTGAGTGTGCGGTAGGACGGGCGCAGGATGGGGGTTCGTTTTTATGGCCACATGCGAGAGGCGCGTTTCGACTATAAAACAAACGACCGACCAACAACAAAAACATTCGAAAAACCAAAGCAAAAATTGAACAATACATACTACATACTATAATACTTTATAATATACATACATATTGTATGTACTTATGTATGTGCTATGTGGCATTTTCCTGTGTTGATGCAATATTTAAAATGCTAATTGCAAAAATGGCGGCAATGGCGGCGACGAGAACTAAGTAATGGCAACTTGGCAGGC ATCCTGGCGCGTGATATGAGTTTTATGTTCTGCCACCCACACACCCGCGCACACACGAATGTAAAAAAAAAAGCGGCAAAAAATAACAAGTAAAAGGCGCAGAACATAAAAAAGTTTTTACACACGCATACCCATTTACATGGCCAGATAAAATGTCGTTGCGTTCTCTGACCTCATACCACCCAACATTCAGCCTTCTAACCGCCCATCCGGCCAGCCCCCTTCCCCCTTCTCCCGCAGGACATGTTCATTGATTAATTCGCAACTGCTCGCGCACTCACATTTGCACTCAGATTCATCTCTCCTTCCAGGAAAACTCTGGAAAACCCACCGCTCTCGTTTGCCTCGCTTTCGTCGGCATATACACCACAGCAGCGCCATCTATGGGTCGCGTGTTGCAGCGGCTCGCAAGTTTTAGACACTGTCTTTTAGCTTTTGCGCCATTGCGCACTCATAAATAGATAGTTTTGAAACATATTTCAAATAAATATAATTGTTCATATTATTAGGAATTTGTTGGCTTTTGGGGTCGTTAAAATTCCCAGCGAAATATCCTTTTCTTGCCTTCTTATTTAAAGGATTCACAGGTAAATGGCAATGGCGCGATTTCTTTGTGTTTGCGTTTGAGCAAGTCACTCAAATTGGGCCTTGGCTTAAACCAGCCCACCACCAACAGAATAACGCCAGCTCACGATATTGCCGGGAGCCACTTTCAGTCTCGACTTTTGACCGCGCCACTTGAGTGGGCTGTGCCACCTGCCTCTTGCCTCTTTCCTCTTGCCTCCTTCCATGCGAACAATTTAGAGCACCCAATCCACCACCCCCTCGAGTCCTTGTTA


Search Again