CR00874

CRIMIC CR00874

Gene bgm

CG4501

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79335

Images

Construct Sequences

sgRNA sequence
GGGAGAAGTGTAGAACTAATAGG

Amplicon 5' Amplicon 3'
AACTTCGACTTTGTGTGCGCATAAATTATGTAAAAAGGATGCACAGTTAAAGTGGCTGCAACGACAGAATTCCACTCGCAAACTCCCATTCCCTGCATTTTACATGGTTCACCCAGCTTTTCGGCCAGCTTCCTGGCCAAGGAAGCCATTGAGGGCCATTAATCATTATATTGAAAAAAGCGCCTTTTAAAAGGAAAAGAAAAATACTAGAAAACAAATTGGTTTAGCTGGTTTAGTTTAGTGTGCTCGTAAAAATTGTTACTTCACTTGGCAACATTTTTTTTTTTTCTGTGTACATGTGTGCCGAGTTTCGGTGTCCGCTAAATTATGCAAGCCAAGCGGGCCGACAGCGCTTCTTAAAGCGAAAATCACTGACAACAACATTACTCATACGTCACGTGGAACAGCTCCCGCTGCTGTTGCTGCTGCTCCTGCTGCTGGTGGTATGTACCAGAAAATAGAAAATGCACGAGGAACAGGACCACGACTAGGAGCAGAGCCAGGACACGCCATGCGGGCACGTCCTCTTAAGTAAAAGCGGGTGAATGGAGAGAACTTCA GGGAGTTTCGTTTAAGTGCAGATACTTTTGCAGTGACTGGAGCATTGGGAAACCCAGCAGGCGGTCCAAAATCAAGCGAAAATTAAAAGTAATTGAGGGAAATTTAAAACGAAAGCTTTCGCAATTTTACAAACTATTTATTAATAACTAATAGAATTTATTGCTGACAGAAAATAGTTAGACGAATTCGAACGACTAATTGGCATCATGCTATTGCAGGTGCATTTTGTAATCCTTTGTTTATTGATGTGCGACTAATTCGCAAACACCACACATTCCATTACACATACCCACAATAGCTAACCCCAAACCTTGAACAAAAACTCATCAGGCAACAAAGCTAATTAAACTTTTTGAACACAACTTCTCGCAGCAAGAGCTCCGGGGGATTCCGGTACAAGATTGCCAAGTCGCTCATCATGTCCAAGGTGAAGCAGGCCCTGGGCTTCGATCGCGTCCTTACACTGGCCAGTGCGGCAGCTCCCATGTCGCCGGAGACGAAGAAGTACTTCCTCAGTCTGGACCTAAAGATTGTCGATGCCTTCGGCATGTCAGAAACGGCCGGTTGTCACACCATCTGCCTTCCCGATTCCGTGGGTCTGAACACAATCGGCAAAACTTTGCCCGGCTGCGAGTCCAAGTTCATCAACAAGGATGCCAACGGTCACGGAGAGCTGTGCATCCGAGGACGTCACGTTTTCATGGGCTACATCGACAACAAGGAGAAGACCGAGGAGTCGCTGGATGACGACTGCTGGCTGCATTCCGGTGATTTGGGATTTGTGGATGACAAGGGTTATGTTTCACTGACGGGACGATCCAAGGAGATCATCATTACCGCCGGCGGCGAGAACATACCGCCAGTGCACATCGAGAACACGATCAAGAAGGAGCTGGATGCCATTTCCAATGCCTTTTTGGTGGGCGAGCAGCGCAAATATCTCACTGTTCTGATCACCCTAAAGGTGAGTCTTCAATCGAATCCAATTGGTTGGAAAGTATTTAATTGTTTTTTGATTTCCAGACCGAAGTGGACAAGGATTCCGGTGAGCCGCTGGACGAGCTTAGCCACGAGTCCTCCGTGTGGGTGAAAT


Search Again