CR00873

CRIMIC CR00873

Gene CG9304

CG9304

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79334

Images

Construct Sequences

sgRNA sequence
GGAGCCAGCTCCATACCAAAAGG

Amplicon 5' Amplicon 3'
AGACGGGCGACTTCTTTCAGTTCCTGGCGAAATTCGGCTTCAACAAGGCAGATCTGACACGGCGCAATGCCTATGGATATATCTACGGCAATGTCACGTCGACGGATAAGTATGCGGTTCCTTTGACACTCGTCGTCTTGGACAGAAGGACTTTCCTCGAGTTCTACGGCAACCGCAGTCAAAGGAGCCGGGAAGCCGCCTGCACAGGGATGTTCTCCCGCCTCCAAAGGATCGCCTACGATTCCACGTGCAATCCTCGTGCCAAAAGGGACTTCCTGCGTCATGTTCCCTGTCCCGTCAATCAGCTCTGCAGCGATGAAGATGAACCCGGAAACGTAGTCCCGGGATCGCAGTTCACCTACGTTATCAACCTGGAGGCGGAACCAAGGTGAGTTATGGGTTTTTCTGGGCTTACAATTCGGAAGATAAGAATTGGATTGCAAAAAAAAACCCAATTCATCTTCAGAGACTGCCATTCTCTCTATATATTGGCCTTTTGGTATGGAGCT GAGCTGGCTCCATGCAGATAAAATGAAACCTTATATCTTTGTTTGTTTGTTGCGGCATTCCTCTTTTGTAACGGAAAACTGAGATAACATTTGATTTGGAAATGACTTGGAATAATTTTATTTTTCCATAGAAGCATTGTTGTTTTAACTGGTTAATGTATTTTGTTGTCCCCCGCGTCGTTGACAGATTTTGGTACCTCTCCCTGGTGGCCTGTTATCAAAACAAAAGCACCTGCCAGTGGCACGCGCACGAGAGCCTGCCAAGGCTAAGTAAATTGGACAGCAATCTCCTCAACACGCTGCACTACGACATACATCTGGTCAACTTGCATCCGAACAACTCGGCCGCACATCCACTTACCTACCAGTACTCGTACGATCAGCAGAATCTACTGGAGATGTACCTGGTGTTCCTGCTCGTCTACATTGTTCTGCTGCCCATGCAAATTTATGCGGTGCGGCGGCAGAAGCATCCAGTGACCAAGTTGTTTACCGTGAGTCTTCTCAGCGAGTTCGTCAGCCTGGCTCTGATCACCGCTCACCTGATTCACTATGCGGCCAATGGAGTGGGCGAGCCAAGATTGCAGGCAGCTGGAGATGTCCTGGACATCTTGAGCCGCACCACATTTATGTTAATTCTGCTGCTGCTGGCCAAAGGATGGGCAGTTACCAGACAGCAAATCAGCAGAACGGGA


Search Again