CR00871

CRIMIC CR00871

Gene cdc14

CG7134

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79333

Images

Construct Sequences

sgRNA sequence
ACTTAGAAAATACGCGTAGATGG

Amplicon 5' Amplicon 3'
AATCCGACGGTCTGCATACCTTATAACTAATAATATTTACAATCGATAAAGGATTGGTCTACGGGATAAGAAAGTGTTTTTTTTTCGGGGGCAACGAAAGTATAAATTAAGTATAAATTGCGATAAAAAACAGAGCCGCACACGTAACGAAATCAAATCCAATGCAAGTCGAACATATAACATATAATACTTCGTCGTGGAGTTTTCGAGTTCAATGGTCATTTTTGGGATTCGGAGGCATTATTCGTTACTTACCTTTTGCTATAGAGCGCCAGGCTGCGGGTGCGACTGCTCCCCGAACTGGCCAAAATATTGTTAGTTGTATTGTTGTTGTTGTTATAGTTATTCAGGGAGTTGCTTAGATTACTGTTGTTGTTGTTGTTGTTGTGGTTATTATTGCTACTGCCGCTAGTCCCAATACCGCAGTCATTATTGTTGTTCAGATTGTTGGCCAAAAGAGCGGCTGTCCCTGTGCCAGTTGGCAAGCAGGAGGAAGTGGGCTTCAAGGCAGCCATCGCTGTATTTCCACCCACTCCATTGTTATTGTTCCGGAACGGTTGGGATCGAGCTCTCGTATGCCTCACGTTCGATTCCTGTTCGCTGCTGATACAACAAATATACAATCGTAATTTAGCAGAAGAAACTTTGTAACAAAAATAAATACATTCAGATGCACTTGAATTTCTAGACATATTAAGCAATTGAAGTGCCATCTACGCGT CAGTCGACCTACCTATTGCTGTTCACATTAACGGATCGCGAGTGATGCCTTCGCAGCGCCTTGATCTGATTCAGCTTGTCGCCCTGCGTCTGGGCCTGCTTCTTTTCGAGCGCCGTTTGTGTCATCCTGACGGTGGACGCAATCGTGTGTCGGGCTGCCTCGAAGACATTTGCACTTGGCTTGCGCAACTTCTTCTCCGTGCAGCTGGCCAACTCAGGAGTGGGATAAACTCCAGATGCCGTACTCAATCCACTGCGATTGGCATTGGGATTAACCAGGCGCCTCAGGGATGTGGCTATTACTGTCGGTTTGTTCGCGCCTGATGGAGATTTCCTACGCCGTGTGGATATTGTATAGCTGGAGGTAGGCGGCGGATCCGCTGGTGCACTGATCGTGTCCGTATCGTTGTCATCGCTATTATTGCAATTGGGATCCTCAACGGATTGATAGAGCGCTCTCTCGTCCCGCTCCAATCGCAGCTGCTCCGAGAGTTCCTCATCCGTTTGATCCGTACAAGCTGCATCTAAGTTATCCTGGTCATTCAGGTGCATCGTATCTACCCGCTGAGAAATGCCCTTCACTCGGGTTAAAAGCAGATCGACGTGCTCTGTGGAATCGGCGGCAGCCGAGGCCAGTTTTTTCTTCAGCTCCAGGCTGTTGATACCGTACGTATGCTGGAGGATGGGAAGCGAAGTGCGCCGGCGCATTCGTTCGCCCTCCGACCACAGCCAGCTTTGTTTGCTAAAAATTTGGAAAACATTTGTGATTCTTTGAGTAAAATCGTGGGGTACTAAGAAATACGTACTCTTCCATCCACTGCTGCTGATGTCCAATCACCGATCCCGGCCGGCAAAGCCTTAGCCAGGCTATGGCCTCCAGAGCAGTGAATCCGTAATGCTTCATGATATATGCCCCTATCAGGCTGCCCGTGCGTCCCAAGCCCGCTTTGCAGTGAACTGCAATGGCTCCCTTTGTCGTCTCACA


Search Again