CR00870

CRIMIC CR00870

Gene x16

CG10203

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79332

Images

Construct Sequences

sgRNA sequence
GATCGACACAATGATTGTGCAGG

Amplicon 5' Amplicon 3'
CAAAGGTAGCCTCTTCGCCAAAGGCATCAACACGCGTGGCAAGCGACGCTTTGGCGGCCAGTGAACGCGACATTTTGCCCTTGTTCTTCTGGCTTGCCTGTCCCACCAACTGGGCGTGATAGATCAAACCGTACTTTGGAGTATCCTTCTTGGTCTTCAGCGCACGGAAGAGTGCTTTCTCGGCGCCCAGAATTTGTACAGTAGATGAGGGATGCTTGGCCAGGTTAATCAGCGAGCCAGCATGGGCAATCAGTCGAGCGCCGACGGTGTCGCCCACGAGCACTGTCAAATTCGGAGCCATGGCCATCATTCTGGCCTTCAAGTAGTCGTACAAGTGGGTGCGGTAATCGTTGATCGATATGATCTCGTCGCACAGACACTGAATGTTCAGCACATCCTCCTCGGAGATTTCGGTACCCATAGAGATCTCAGCTGCCTCCTTGACCTTTTCCTCCACATCTTCTGGCAGAATGTCGGACAGATCGCTTGTGGCCATATTATCCCTGGTGCCCACCAACTTGATGGTCTTCACGAAGGCAATGTTGTCGGTAATAATCTTGCCCAGCTCGGGAAAGTGCCAACCGTACCACTCGCGTGCACGCATCATGTAGTTGTTCAACTCCTTGTCCAGGTCATCCAGCAAGCACTGGGCCTGCACAATCATTG GATCTTGTCGGGCGAGAACTTAAGCTTGTAGCGCGACAAGGAGTGGGCAAGACCCAGGGCCATGGCGGTCATCTCACGCTTGGGCAGACCACCAAGCAGACTGTCCGCCTGCTGGCGAATACAGCGCATCAGCTCCTGGACGCCAGTGTTGCAGACACACTGTACCGACAGTTTGTCCTTGATGGCTGTGCCCAGTTTGGCATCGGCAACCAAGAGCGAAGACTGCACGTCGTCAACGAGCAGCTTCTTGAGTGTCTTTTTCAGCGGCTTGGCTACCTTGCCCTCCACCGCCGCCGTTGCAGCGGCCAGCGCCTCTGTGGTGTCATTGAATTTCTCAAAGTGCTTCAGCTTCAGCAGCTTGTTGGCCTTCTCCGGAGTCTCAAACTCCTGGTACAGATTGTCCACCTGCTCCAGTTTCTTTTCGTCCAGCAGCTTGAAAATCGCGTAGCCCGCCGGCGTTTCGTAGAGCACAAACATCGCGTTACGCTCTGCTCATTTAGTTTCAATTTTAATTCAATTTAAAACCACCGAAACTCTCGGCAGCCAGCAGCAACTTAACCTTCTTTTCCGTATGCCGCGTGTAAAAG


Search Again