CR00869

CRIMIC CR00869

Gene CG9536

CG9536

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79331

Images

Construct Sequences

sgRNA sequence
ACTCTGCCCCTAGATTTAAATGG

Amplicon 5' Amplicon 3'
GCATTTGCACCGATACCGACGTCAGGCTGGCCGTAGATATCGTCCGCAGCGGCGTGGGCGTCTTGACCACGCCCGCCCGCAAACAGCAATTGTAAATGGGATTAACCAATACGCTGATAAACGGCTGTGATACGTTTGGGAAGAAGCTGACGAACGTGAAGCTCTCCGAGCTGTCGCCACGCCCATTGGGATGGTGTTGATAGAAGCGGAGATAGATCCAAGAAACCAGCGATCCGGAGGCGAACATAGCCGGATAAGTGCCATCTAGCAGGCCAATGGCCCACAGTATGATGGCCATGATGAGCACCGTGAGGGGAACGTTCCTGAGTAGTAAAGAGTACATTTGTATATTCAAGTGGCGGCTATGATTCAGGATTTACTTTGAGAAATACAATATAGTATCTTAAACAATGGTGTGTTTGTTATTATTTACAAAGTATCATTTCATAGAATTCTCGAGGGTATTTACTTGCGCGTTAGTAAACCAATATTTATTGAACTTTGACCCAAAGTTAAAGGGCTGATGAGCCAGTAAATTCTATTCAATTTATTGAGCTTGCGCCCATTTAAATCTAGGGGC GGCAGAGTATGAAAAATTACCGCTCTTTGATTCTGTGAATGTATCTTTTTAGGTTTAAAGCCATATTTGGAAATAATCGAGAGATTTCTAAGACTAAACTTTCTAAAGCGAGCTCTTAGCTACCGTGTGACTCTGAAATGGAAACATATCAATCAATTATCTCACCTATTGGTCAGACGTCCGTAGCGCGTCTTGAAGATCAGGTGATCGGGCATTATCTGGCGTACGGCTACGCAGATGCCAGCCACGTATCCGGCCAGGCCGTGAATGTGCACCTCGAAGAGAATGGTCGGGTTCTTGGTGACCATGTAGTAGAACAAATAGTAGACAGTGGTCAGCAGCGAGACGCCAAAGTTGCTCAGCGCGAAGAACTTGAACATCTCCAGCTGGCCCCAGAGCGGTTCCAGCATCTTGCCGCACAGGCCGACGGTGACCACGTCGACGGCCACCTCCCACCAGTGCAGCTCGATGAAGCAGAACGTGAAGGCGGTCCATATCCAGAACTTGCCATTGGGCAGGATGTAACCGGGAGTGACGCTGAGCAGCAGGATGGCCGTCTCCGAGAAGGATAGCAGGTAGCCGAACGTGGTCACCACGCAGATGAGCGTTATGACCGGCGAGGTGTTGTGCAGCAGAGCATTGAGCTGTTGCCAGATGTACGGCCAGTTTCTGGCCAGTTGAGCTGACATGGCACCGATCGCTTCTCCTGGTGTTCGCACGCGTTTTTCGTTGGCCTCGCAGCTCCTGGGCGGCGGACTGGAACCGGGTGGTCTTGAATGCGCTGCGGTGCTTGTCTGCCTCGCAACTCAACACGTTCGAGGGGCCTTAAAGTGGTTCATTTGCTAATATTTACGAATTTGCTTCACAATTACAATAACAAGACTGTCATCGAAGTGGAAAGGCGTAGCTATCGTTTATCGATTGTTTCGCTACAACGTGACCAGACCGTTACC


Search Again