CR00868

CRIMIC CR00868

Gene CG34124

CG34124

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79330

Images

Construct Sequences

sgRNA sequence
CTCGTGTTGGCAGTGTGAAGAGG

Amplicon 5' Amplicon 3'
ACTGAAGAAGGCCAATCCCGGCCTGCAAATTGACATAGAGTCAGCGCTGGCGGACTCGGAACCGGATGAGGAGGAGGAGCCGCTTCACATCCCGACCGTGCCCAACGCCATAATCTGGCTGCGTTACACCCTAAGAGACACAATTTGGGTGTCAATGGCGGGCTACGATGCTGGTTATATCTATGAGCTGGAGTTCAATGCGGCGGAGCCCACTCGAGCCACCATCATAGCGGAGGCGGATGACATCGAGATTCATTCGTATTGCATAATGTGAGTTTAAGCGCTAGAGATGTGGCATATCCTGGTATATCCATTTACTATCTCTTTTCCAGCGATGAATTCATCATCTTTGGTCTTCACAATGGACGTATTCGAATCAATCGCATCAATCCGGACAATTTCACCGACCTCTCCGAGTTCCGCATCTATCCCATGCACGACGGCCTGAAAGGCACCATTCCCAAGATCGACATTAGCTACAGTGGTGAGCACTTACTCACCATTGGCTACGATGGCAACGTGTTCCTGCACAAGTGGAACGGTCCGAAGATCGTTAGGAACAAGGTGAGGGATAAACTGCCGCCCCTGCCGGAGGGAGTTACCCAGATTCCGGACATAGAGCCGGAGGCTTGCTCCCTTGAACAGGAGAAAATCAACGCGGAGCTGCGGCGGCAACAGGAAGCAGCCGATGCACATGACCGTGATGTGCTCAGTAAGATCGGAGCGCTCCAGAACGTCTACTTTGACATTATCAGGATCAACGAGGAGCTACCTCCGGGTCTGAGGGCCAAGGATACCGACTTGCTGCTGGACGATCGTATCACCCGGCAAATTCGAAATGAGCTGCAGGCAGAGTTGGATGACGTTCGAGAGGATCTGGCCTACGATTTGGAATTTGCCCAAGTGGGACACACGAAGCTCTACAATCACTTTCTCAAGGAACTCGTCCAAGTCCCCTTCACAGTCGCTCCTTTGCGGTAAGTAAAAGGATTCCTATCATTCCAACAGATTTAACATTGTGATTTTAGTGCCAACGTGCCGGGTGTGTCCACATTTCGCCTGCAGGCTCTGGGCGAGGAGCATGCTCAGATCAAGCAGGATATAGAGGACCGCCTGAAGCGGGAGCATGATATGGGGTAAGTGGCGAAAATCAGGCTCCACCTCTTCACACTGCCAACACGAGAA CACACTGCCAACACGAGAAATATATACAATACATACAAATCTTACTCTTACATTCAACACAAGCAGCCTTTACACGGAGGATCGAGTACTAGAGCAACCGGAAGTGTAAGCCATCCAAGCTACTTAGTTCCTAGTTTGATCACCTGTCCACCATAATTATTGATTACACCATCAATGCATATTACAAATCATAGATTAAACTTTAATGGCACTAGTTAAATACCTAATACCCAATGATTACAGACTGCATGACTATGTGGCGCCCGAGAGATCGGACGAATCCATTGGGGAACCCCCGCCGGAGTCGTTCTTCTTTGGCCGGGATCCGAAAAGCATTGAGCCGCGTTTCAGCAAGAAGATGATGCGACTCCTCACCCGCTATCGAAAACGCCAGATCTTCGAGGTGCGCCGCATCTTCGACTGGGACAAGCTGGAGCGCCAGAAGCCGGACCCCAATCGTAACCATCCCGACGACGATGCCCAGATCGAGGATGCCAAGCGCAACCTGGGTGACTTCAAGCTGAAAATCGGTTCGGACTACGAGCCCAAGTCATCGGAAACCTTGACCCAGAAGTACATAGAGGTGGTGGAGTGTCGTGAACAGTACTTTGCGATGGTGGACGCCTTCAATCAGATGGTGCTGGATCTGCGTGAACGCAAGGGTGAGCTGGACCAGTTTATCACCGCCAAGAGAAACCGCTTGGCAGTCATTCATAATTATCTGCCCGAGCCGGACCGTCAGCCCTTGGATCCGATTCAGGAAATTGACATGGACCTGGAGTACCCAGAACTTAATCTCATCGAGCACTATACGCCCGGCTGTGGAGTGGAGATCGACGACATCCTAACGCTGGAGCACAGTGTAGACCAGGTGGGTGAACTGAATGTTACTACTTTTAATTAAGCATGCATGCGTACATCTTCTATGTAACAAGGTGATAGCCAGGATGGCTCCAATGAGATCCACCGCCAACGTAAGCCTTTTCAGTTTGCACGGCTTGGATGTACCCGAGCTGCACGAGCACACCGCATTCACGATGCTACAGATCTCAAAGCTGAACAGAAGTCTTCCCAATGCGGAGCTGGACGAGGAGCTGCTAAAGCTGCCGCCCAAAAGTGATCCGGCCTACTTCGAG


Search Again