CR00867

CRIMIC CR00867

Gene for

CG10033

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79329

Images

Construct Sequences

sgRNA sequence
TCTGAAGAGATGCCGTCGATGGG

Amplicon 5' Amplicon 3'
GAAACTCACCCCTGGAGAGCCTTCTCTCCAAAGAAATCCCCTTTGCCCAGCATGCGAATGAACTTCTCCTCCTGCGTGTCCTGCTGCTTGATCGTCACTCGCACTTTTCCCTTGGATATGATGAAGAAGGTATCGCCTCGGGCGCCTTGGCGCACTATGTAGTCGCCACGCTGGTAGTGCGTCTCCTCCAAAACATCGGAGATTTTGATGAGCGTGTCTTCCGCCAGGTCTTTGAAGATGGGCACACTAGCGGTAGATAAGAAGACCAAAAATTGTTAGTTTCATTCGAGATAATCTGCGTTGCAGGCCAAAGAAAGTGCTGTAATTAGTGGCCGAGCCAAGTTCGATCTAGATAAGAGAATTCCATAGTAATGGGAATCTATTGTTGACCTACATCGATCTTCAAGCTGAAAGTCGCACCTGAACTCCTCCTCCCATTACTGGTTTCCCTCCGGCTGGAATTTTTTCATGTGCATCGCACACATCTTTTGTTGTTACACTTAACAAAAATATTAACAAGTTATCTTCCACATAGCCACCGTTTGTAGGTTTCAGTTTAATCTATCTAGCATTTTCGATTCTCTTCGATATTTGAGGAATATTTCTTTATCTTTTTCTCTCTCTGTAGAGCAGCGTAATCGAAGCTGAACTCCTCCCATTCTGTTTTTTCCCGCCGGCTAGCATTTTTTCAGTGAATGCTCACATGTATCTAGAGTCTATAGCTGCAGTTGCAGTTGCAGCTGCAGTATCTGTATCTAAATCTATGATCATCGTCATCATCAGCCCATTGCACTTTCATTTTCAATCTGCTTTTTCCGCTACTTCTCGAATGTGGAATAGGCAACGAGTGCATGGTCGAGGCCTCAATTATGGTTTTTAGCAGTTTTTACGGACGACCAATTAAACGCGATTAATTTGCCGGTCACTCCGGAGGCAGGAGCGACTGGAGATGGAAGTGAGACTGGATACAGCCGCGCAGACTTGGCCAAAAAACTGGTTGCCATGGCTGGCATTGGGAAAGAAATTTCTATGCGTTCGTTGGCCGCAGCCTGAAGTTTAGCTGAAGTGAGTTTTCATTTGAGTTTGAGCCATTGCACGTCATATGGACGCCCAACACCATGACGATGATGAGATGGCCATAATGCTGCATTCGATCTGAAGAGATGCCGTC CCGGCGGAGAAAGTTACCTTACTTTATTCGCCATACCTTGCACGATTTGAACACACAAATCGACCGGGCTAAAAAAAAAAAAAATCCTCAAGCTAAGCGATTTTTACATTTGCCATTATAGAGTAATGACCATACACGAGCTGCACTGCGGAATTGATATAATTAAGTGTAAATGAACATTAATTACGCCCAAATTGCAAATAACCAGTCGGCACCATCTCGCCAATAAATCGCCACAGGCTCAGAGGCTCATTAAAATGCACATTAAATCGCCGATTGGCAATGGGGAAGTCTCTCCTGGTCTGGTCTTCGAGAGGAGTGGCCGAGAAGGCGGCGATGAAGGAGGTATTCCAAGGAGGAAAGCCACGGATCGGGGAGGGCTACTCACCTCTTGAGGAAATCGCTGTACTCCGCCTGCCGGATCAGGCCCGTTCGCATCATGATGGTCTGAAAGCACTGGCGCTCGATGGCCCACAGGTTGCACTCGGTGATCGCGGTGATGGTCGCCGTCCGCTGGCAGTTGTACAGGATCGCCAATTCGCCAAGGACCTTCGCTCCCGACAATGTGGAGAGGTACTTGCCCTCGCGGGAAACCTCCACGCGTCCATCTGGAGAAAATATATTAAAATTAATTGGGTAATCATAATCATAATTCTGTCCTATCCTATTGATATAAAAGCTACTATGCCTATCCTGACTTAAAACATAGAAATCCTTCCACCCCTTACCCTTCTCTGCTTCCTCCTCCTGCCCACCGCTGGATTGCTCCTTGAGATTTCCCGTCCTGCGTCGACGGGCATATGTGTGCACTGGAACGATGAGGCGCGGTCGTGGGATACAGAAACCCTCCCCGTTGAGATCCTTGGAGCTGCCATTACTGCTGGCAGCTGGTGAGATTTGTGGACTCTTCTGACGAACAGCCTTCTCCCCCTCCAGTTTGAGTCCCTCGATGGCCTGCTCCAAACTGAGACGT


Search Again