CR00866

CRIMIC CR00866

Gene Acn

CG10473

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79328

Images

Construct Sequences

sgRNA sequence
TCACTGACTCCCTGGAGATTAGG

Amplicon 5' Amplicon 3'
GGTCCCCACTTCCACTGATGATGACACCAAGCAGAGCGAGCCAGAACAAGAGGTAAAGGTTCCTTCTCCTTCCAGCAAGGATGAGGAACATCTAAAAACGACTAGTGATGTATTAGACATTCAGACAGAAGAGGTCGATGAAAGGGACGAAGAAGCCTCCGCTCCTGCGGAGCGCAGAGAAACCAAGAAGAGGCACAAGGAGCAGATAAAGGAACAGCAACCCGCAGAGGAGGAGGAACACAAGGAAAACCACAAGCAGATAGACGAAAACCCAGAACAAATTCACGATGAACCAGCAGATCTTTCGAACGACAAGCACGATCCATGTCTAAACAGCAGCGCAACCAACACAACCGGTGCTCCAGTTCTGCAGCAACAACGGTCGGTGCGGAAGCGAAAGTGGCTGACTAACAAAAAGTCTTCGGATCGTACCCCGCCCGTGCTTGCCATTTCGACGGATTCCCTGAAGAACATTATAGCCGATGTGGTGCAGCCAGTGCCCCTAAGCGATGTGCAACTGGAATCGTCCTCAGAGGAGGAAGGCCTGGTCACCAGCGATCGCGATTCAGAGCGATCTGCTTCACCGGCGCCCCCATCTGAAGCAAGCAAAGACCGCGATAACAAGGGCAATACCGCCAACACCTGCGACACCACCGCAGAGGCGTCGGCAGATAATGAAGGAGCAGGAGCCGCTCCTCCAGCAGCAGCAGACACGGTTTCAGCCCAGGTCAGCCTGAGCAAAGCCACAGTTTCCACGGCAGCACCACACATAGTCCGTGACCCTAGTCCTGCTCGAAACCGCGCCAGCCACGTGCTCTATATCACCAATTTGGTACGCCCCTTCACAGTGCTGCAGCTGAAAGGCCTGCTGGCGCGGACGGGAAAGATCGTTGAGGAAGATGGTTTCTGGATAGATCGGATCAAGTCTAAGTGCTATGTTGCCTATTCCACTGAAGAGTAAGTATTGTAGTTGCGCAAATAGAACCTAATCTCCAGGGAGTCAGT CAGGGAGTCAGTGAAATATGCCTATAAAAAACTCACACTTGCAATTATTTTGCTTTTCAACCTTTAAGCGAGGCCATCGAAACCCGACATGCCCTGCACGGAGTTCGCTGGCCAGTGTCAAATCCCAAATGTTTGAATGTAGATTTTGGCAGTCGCACTGATATGGATCGGGCAATACTTTCAACGAAGGACGAGGCTCCGAGGTACGGGCAGGAAAACACCAGAGATAACCAGCAGTCGGGCAACGCTTGGTCCCGGTTGGAACCGTCTGACAAAAAAGTAATGGATTATTATCACAGCATAGAAATGCGGAGCTAACTTGTCTTTTTCCTTCAGCCTGCGCGACCTGTACGCGAATGGGATGTTGGCAAAAAGGAACCAAGCGACCACGACAAACACAGCAACGACAGGCGTCGGGACAGCAAGGATCGACTGGACTCGAGGTCTAGGGATGCGGAGCGAGCCGGACAGGAACGAAAGCGTTCTAGGGACAGAGAGGGGCGAGGACGCGATCGGGAGCGGGAGCGACTTGATCGCAATGCACATGCAAGGAGCCGCAGTGGATCGCCAGGTAAAGCCCGTGGGATACATTTTCCTGTCATGAGAAATTCAAAAACACCCCGTTTAAATAGCGTCCAAAACTAAGAAGGAGAATGAACCGCCTATCAGACTACTAGATGATCTATTTCGAAAAACCAAGGGAACACCTTGCATATACTGGCTGCCACTTACGCCGGAAGCGGTAAGTTGCTGAGATAAATAGTTCCAATCAACGAGAATCACTTCTAGACCAAGTCCGCCTGA


Search Again