CR00865

CRIMIC CR00865

Gene milt

CG43227

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79327

Images

Construct Sequences

sgRNA sequence
ACACAACAAGAATTATAAATCGG

Amplicon 5' Amplicon 3'
AGAGCGGCAACTACATGGACAGCGGCAACGTGTCGATGACGCAACTGGGAGCTATGTCGATGAGCAGCTCTTCGGGGCCGCGCATGGCTTCGATGGCGTATCCAGCGGGCTCCTACTATCGTGGCGGTAGCAATCAATCTCTGGGAGTTAAAACTCTGTCAAGCGAGAGTCTCAACTCCCAGTCGGATGACGGTTATCCAGCCCAGCCCTCTGGTGTGCCAGGAGCGCCCGGCGCCAAGGAGCTGGAGGCGGCTCTCAAGAGGCTGACGCCGGCTGAGGTCTTGGCTCGCCGTGCTATGTTGTCCTATGCTCCGGCTGGAACCTATAACTACGACGAACCAATGGGTCACGGTACAGGTAACGTTCGAAACTCGGATCTACCGCTGGGTGTGCGCACGCCGGACAGTATTATGTCCACCGGCTCGTCGGGAATGTCGGGCTCCACGAATCACATGTCCGCTTCGATGACGCATCAGTGGCGACTACCCGAGAAGCTGCAGATCATCAAACCCATGGAGGGATCGCAGACATTGCACCATTGGTCGCGCTTGGCCACGCCCACGCTCAGTGGACTGCTGGATGAGCGTCCCGGCGTAACGATCCGTGGTGGACGTGGCCTGGATGATCTGGGAATGCAGATATACACGCTGTCGGACGTAGAGGAGGATGTTAGCGATGATCTGCCCGGCAAACAGTTTGAAGCACCGGGCTGCACGTTCACCTACACCAATAGCATGGTCATGCATCCGGACGATGGATTCGTTAACGATCTGTCATTCCTCTCGCAGTCGCAGATGTCGTCCCGAATGGCCTCCACGTCGACATCAAGGCAACCCAGGTTAGTATTATTAAGGGTGGATAGAATCAGTATACTCGTTTCCTTCTTTTTTCTTTTTTACGCATTATTTCTAAGCCCGATT CACTTTCAGTTGTCCTGCCACGCCTCGCGCTGGACTATCGCGCAAAAATTCCTGCTCCACATTTTCGGTGAACCTCGGACTCGCTGGAATGCTGAATGAGAGGGGCATCAAGGCGGTGACGCCCAGTGCCCTCAACACGCCCGCCGGACCTAACTTTTCGCCCACGGTGACGCCATGCAACAGCCCGGAGGGATCACCTCCTCGTGCCCAGTCGCCCGAGCCGCTCTTTGGTCTGCTCTCGTGTGGTGCGGATTTGATCCGGCGCAAAATCGTAGGCGATCAGCATCAGCAGCAGCAACAGAAGCAAAGGAGCAGCCTTAGCAAGCAGCAGCAGCAGAAGATCATGCTCTCGCACCTGGAAAGACGTGCCCTGCGATCGCTGAACCTAATTGAGAAGGTGGAGAGCATCGGACTGGAGAACATAATAAGCGCACAGAGAGGCCTTGGCTCAGGAATCGCGAACCGCAGCAGTTCGCCCCTGAGCAGTGGCAGCCTACAGAGTCTCCACACCAGCAGCAACAGCATTGTGGACGACATACACTTCGATCGGGCACAGATCAAGGGTGTCCTGCATCGAGGCCTGAAATCGCCAACGCCCGCAACAGCATCAACATCTGCAGCTGCGGCGGCTTCAGGGCCAGGTATCTCGA


Search Again