CR00863

CRIMIC CR00863

Gene pelo

CG3959

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79326

Images

Construct Sequences

sgRNA sequence
CAGCTCGGAGATGGTGTAGTCGG

Amplicon 5' Amplicon 3'
ATTTGTTGGCCCCATAGCGACGTGCTCATGATCAAGGTTGCCCCAATGTCTCCTCACCATTTTTGGCTGCCAGCCTGTTTAGTTCTGTTCTGTTCTATTCACTACTCTTCTCCGCAATTTGTTTACACTTTAATGGGCCGATGAAATTCCATTCGAATATGTTTTTGTATGCTAACTGCGTGGCTGGCAATTAAATGAAAATTAAGTGCTATAGCTTTTTCTTTACTTAACATTTAATGTACTTAATGATCTAGGCAAAAGGTGTTTTATTTTAGCACTTTTAGTCAGTCCGCTTAGGTTGCTTCCCCCATAAGTATTCTTCCTCCTTCTTTTTAATCTCAGAAATTGTTTAAATCGCAGCTCGCCGCTATCGTTGTCGTCGTCGTCGTCGTCGTTGTTGCTCCGGACTGGGCTTTATCTCGACATTTTTGATTGCTGCTGATAGTTTGGCCATTGTGCAAATAGAAACAAGATGGGGAAATGTTGTTATGAAATGCTTTGTTTAAGTTTTCCATTTGCCTTACCGCCTTCGCTGCTGTTCATTGCACTGATTCTTTCTCAATTTCTGCTGGTATACGGGATCCTCTTCGAAATCTTCTCTGCTCCTCATCGTCAAGCGCTTGAAACAATCGTCCAACGTTTCCCTCAGTGGCAGCAGGCGATGTGGTGATGGCGGAGAACTGGGCATCTTTGTGTAGTCCAGCTTCTTGAGGGACTCGCACGCGGTCGAATCCGACCACTGATGGATGGGATGGCC TGGTGAGCATCTTGGATCCGCCTGATTTGACTCGATTTAATTCGACGGTGTTAAGTGGCCTGCACTTAAATAGGAACTGGAGTGGAAAGATATGTGCGTTAAGTAGTACAGTCAAGTGGAGTTGAGGTTCGGACAGATAATTCAACGATTCGAGTTTCTTTGCTTTCGTTTTATGATCATCAAATCGATAAATATATAAAAATCGACATATATTTGACTGGAATGTGATCAAGTTCCTCAAAATGTACTACACATATTTCGAATTAAAGTCACGTAAATGTATTTATTTTGAAATCATTTTATCATAATATGTGAATATTTATTTAAGTCACATAAAATGAAATCATGCAGTTCAAATTTTGTGACTACTATAAGCTGGAATTTTGCCGGCTACAACAAAAGTATTATCAGCAAATGATTGTGGAAAATATGTAGAGCATTTCTATGAATGTTTGTGATAAGCCAAGATAACTTTATAGTTAACAATATTGTTAAAAATGGTGTTTAGCTTTCTGAGACTTTGTTTCGTCCCTCACCCATTTAATCCGTATCCGTAAATATAAACGTAAATGCTCATGGACGAATTCCAAGCTGAATTTGCGTGCTCTGTTTCGGGTCTTATTTTATAGAGCTGTTTTTGCCAGACGAGTTTCGATTAGCAAATGACGGGGACTGAACTAAACTGTGATGTAAATAAGCTGGGTACAGTATAAGCTTTATATAACCGTGTGGAAATGATTCCCTCAGTGAGCCAATTCTTGTGCTAATTATTAGAACCCGCTGTGGGCGAAAGAAGATTGCGATTGAGGGAGCAGGAACGGCAGCGGGAGAATAGCAATAAACAAGAAAATAAAGAATTTTAATTTATTTAATCACTCCGTTTATGGATCACTTGGCTGGCAACTTTTTGAAGCGGACACTCTCGCTTCCACACAG


Search Again