CR00862

CRIMIC CR00862

Gene CG30349

CG30349

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79325

Images

Construct Sequences

sgRNA sequence
ATTATTGAGTCAGACCCGCGTGG

Amplicon 5' Amplicon 3'
CAGTTGACCTTGGATCGGCTACCGCTCGATTATGTCAATCCCCTGGTCAACGAACTTTCCATCCTGCTGCAAGGAAAGCACGCGAGGTGAGTGTTTTCCGTAGAGCCCTATTGAGTCTTTTTCTAAATACGTTCTTTTACAGTGTCCGCTCCGCCCTGCGTTGGCTGCACGCACTGACCTCCACCCACACTAGTGTCTTGATGTCCGAGGACAAGGAGGCTTTGCGCGAAAAACTAGCCGTTTGCCTCGGCGTGGCGGAGCAGCGCATGCACTGTCTATCGGAAGCTTTGCAGTAAGTAAAATTGGGGAATTGAAAGACACAAAACAAAGGTTTTAATAGGGAAATCAAGTTCAAGATCCCGATTTCTTTGAATTTTTCGGCTTGATATTATTCTTGGGCTTTTCAATGGTGCCGTGGCGACACTCCGAGATCGCAGCGAAGAAGGTCAGCTTGGTGTGCAGAATGGTGTCGATGTAGAATCGCTGAAAAGTGAACGAGTTGAGGCATCGTTCGCCCAGGCCGTAGTAGAGCGTGTTGTAACCCTCGAAGCGGTAGGTGATCATCACGGGATAATGCTTCAATAGAATCTTCGACAAGGAAATGATGAAACGCACCTTGGCGACGGCCAGAGGATTCGGACAACGGGGTGTTGGCCGAGAGAAATGGGCATCCACAAAGAGAATGGTTCCCTTTTTGGCCACCTCGTGTCGAATCGGATTGCTGATCACCACACACTTCGTGTCCGGCGAAAGTTCCCAGCGACTGACAAAATCCCTAATGTCGGCAATGGCATTGGAGTATTCAAAGTCCCCGATGGTCAGCATCTTGCGCGCCAAGCCACTGGATACGGAGTCCGCCGAAATGCCAAGGCCACCCGTGTAATGATTCGTGATCGAGGGATCATCCTCTCCGTTGGCCACAATGGTGTCGGTGAACACTGAAGAGATCAGGCTGATGGAGGACATCTTTTGCTTTTTCGGAAAGTTGTAGATAAAAAGACCACGCGGGTCTGACTCAATA CAATAATGGCCACCGCTTCGCAGAGTGTGCCTTCGATCAGGTCGATGATGCACTGCATATCAGCGTCATCGCAGGCCGGCTTGTTGCACTGGTTGACTAAGCTGGATATGCTGGGTATTATGGCAATGGGTAGGGCACCGCCTGGTCCCAATGCTGGCACGCCACTGCCTGGACTCGGGGGTTTCTTGTTGTGGGGGCTGGAGAAGTAGTCCATACAGCTAGCGCCATCATTGCACAAAAGATCCATTTTCGAAATCTGGCCACGACAAAATTTAGTAATGCGTGTACTCCTATTATTGTTATATTGGCAATATTGTTATAACACCTTTTCAATGCCTTCTTTATTTTTAGAATAACCGGGCGAGTCAACCTGATAATTAACCAGATGAAACGCAACGCGGACAATCATCTCAACGATAACAAAGCCCTGATCCTGGACGAAGATCCAGGTAAGTTATCAAGTGGTTTTATTCGCACAAGGCTCGAGTCTTAATTCGCTTGCTTGCAGATGAGCCCGATCCCGAAGCAGAAACGAACTGGAGCGATCTGGAGGAGGATCAGCCAGGCAGTCCGAAGAGCCCATTGGAAGACGAGCTGGTGGCCGACGACGACCTGGCGACCGACGATGGTAACGCCGACGCAGACACAGACTCTGACGTATCCATGGATTAGACAGTCTACCCGTAATTTAAGCTTAAATGCAATTCCCTTGTTGTTGCGCCGCGAGAAAATAAATTAGCATTTTTTTCCAAACACAGTCTTTTACATCGAATTCATAAATTTTTATTTACGGTTTTAAACTACGTGCAACAACGAATAGTGAGAGCCAATTGTTGGTCTAATTCCGACACGAGATTTCATCGATACGCAAGCAAACAAACATATCCAGTTCATAAATACAGTTGAATAATGTGCCAATAACAGGGGGCTTGTAGCTCGAGTATACATAAGCGGCGGCTACTG


Search Again