CR00860

CRIMIC CR00860

Gene antr

CG30488

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79324

Images

Construct Sequences

sgRNA sequence
TCCTATTCTTGAGATATAGGTGG

Amplicon 5' Amplicon 3'
GGGATCGCAGTAGTCGAAGGCCTGGAGCTGCTGGCCCAGTAGCATCAGCAGCAGCAACAGCGGCGGCCACTTGGTGTCCAACATCTCGACGAGGCAGCCAGTTTAGCCAGCTCCGGCCACCCGAGGCTGCCTCTTATAGAGTTCGAAGGGGCCAAATCGATTATCGGTCAAGCGGAGCTATCAATTGCGACCATTTACTGACCACCAATCAGTAAAGCAATTGGTTAGGCCCACTATTAGGCACACTTTTGTACACAGAAAAAAATGGATAAGTTCTGATCAAATTTTTCTAGCATTTCGCATGACTTAAATCCGTTATAATAATTTGCTGTCATCGATTTTAAAGGTTTTTATTTCATGAATAGTATTTATGTGAATATTAAGTGCATAAGCACTTATTTTATAAGTGTACAATTATATAACACCCTAAATGTCCACTTGTATTTGGTCGCTGGACGGCATATTCGATTCCACCACCATGCTGTTGGCATCGACGTACTCATCCTCGCTGCAGAGGAACTGGTACATCTGGCTCGGTCCAGTGGCGCACTTCCCGGCAGGAATCTGGCCCTCTTCGTACGGAACCAGGTTGTTCACACTGGCCCGCGAAAAGTGGCAGAGCAGGATAATATTTGACTCCTTCTCGTCCCTACCTTTCACACGAAGGCCGCATCCCATACGAGAACCATGGTCCTGAATCAGGGGCATATAGTGGCCCACACAGGTTCTACAGTAAAAATAAATATGGTCTTAGTAGTTAAATATTGCAATTTCAAAAATGTAATATTAAACCCACTAACATGTGTTCGAAACGAAGTATTTAACCTAATACAATAATTTGTAAAAGATTTTAAAAGGCCTTCTCAAAAGCTGGT GCGTTTTACGTCACTTACCCTTCTCTTACTGGCACTAATTTCTGACTGTTCATCATGCATCCCATGACATCCAGAAACAACTCCGGCAGCAATTTATCTAAAATCGCACTTTTAAGGCTCTTGGTCCGTCCCATCTTGCTACGGATTTCGGTGGTTGCCACATAGTGATACTTGTCGGTATTGGCGCAAAACTTTCCCGTCTCATCGCATTGGCGAACCTGTCTATCCGCCAGCCTCTGCAGTTCAAAATCCCAGCCCATCGTCGGCATGCGAGCGGCTACCGAATAGTTGCCCACTCCACTGGCCACATAGTTGCGCAACATGTTGATCCTGCTGAGGATGCCAGTCTTCAAGGCTCCATTAACGTTCAGGAACAGATTGTTTTTCCCGCATTGCTCACCTACTGCCTGCAGATGAGGTGGTTAAATCACTACAATCTCGAGTAATGATAGCTACTACCTTAGGTTGAAAGCAGCCCACATGAATTTCCGAGTTCATGCAGAGATTGGGCTTACAATGGGGATCATCTTCTGGTATCAAGCTCGCAGTTAGCGGTAACAAAAAGAGGTACAGATACCACATCTTCATCTCGTGGCAAAAGTAATTTAACTAACGTGTAGAGCTATCTTATGACCTAGATTTATTAAATGCAGCATGAACGAATCAATTAAGCTCGCCCAATTGCAGGGCATTGGGATTAACATGCTCCTCGGGTGAGCAGAGCCCCTCATATATGGAGTGGGTTCCCGCATAGCAGCGACTTCCCGGATGAGCACTTG


Search Again