CR00859

CRIMIC CR00859

Gene E(Pc)

CG7776

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79323

Images

Construct Sequences

sgRNA sequence
AGGGTCAGGTATGAAAAGCTGGG

Amplicon 5' Amplicon 3'
GGCTGAACAAACGCCTCAAGATGGTAATAAACACTTAGCTTGGCTATTGGCTACGGCAATATACTAAATCAACTATCTTATTCATTCTCTAGCAACACCCGCTGATCCTCACTGTGAAAACTGAGAGTCGACCAGGCGCCAGCTCCAACAATCCGTACTTGGCTTTTCGTCGTCGCACCGAGAAAATGCAAACCCGCAAAAATCGAAAGAACGATGAGGCCTCCTACGAAAAGATGCTCAAGCTGCGGTAAGAATCGAGTGAAGTTTGCCTAAAGTCGGTTGAGAAATTTTTAAATGCTGGCTAATCGGGCTACACTGCAATTACTGGACACAGAACTTGCAAACATTTTCTTTCTCTGTATCATATAAATTCAATTCCTGCCCGATTTAAATGCAGGTTTTTTATGCATGATATCCTTAATCAGGAATTTTCCCATATACAACATTTTGTTTATAAAAAGCCAGGTAGTTTTCGTTAGCCAGCATATTTTATTGCCCAGCTTTTCATACCTGA ACCTGACCCTAACTAATCCACTCTTTCCCTGTCCTCTAGACGTGACCTGCAGCGCGCCACCACTATACTGGAGATGGTGAGGCGACGCGAGGAGACGAAGCGCGATCATCTCAAGATGACGGTGAACATCTTCGAGAAGCGCGTTGAGATGCGCGACTTCAACGGTGCTGTCTACTCCGAGCTGAATTCTCAGTACAAGAACACAAGGTGCGTTTTCGGACACCTTTTACTTATGAAGAAAGGTACTGAAATACTCCTTGTTTATTTGCAGACCCGCGTATAATCCATTGTATACGAATCAATACTCACAAGGGGCGGCGGCGGTGGGAACGGCTGGTGCCATTCTAGCCGCCCTGCCCACGGGTCTGCTGCCGGGCGGTGCTGGAGCGGCAGGCAATGCAAATGTCTTCGGCTCAGCGTCCCAGTACCTGAACTCGTCGAATCTGACAATGGGTAAGGGTGGGATTACATCTAGTATTTAATTGCAGATGTCCTAATCACACTGCTTTAAATCGCTCAGGGAATATACAGTCAGAAATGAAATTGTCGTGGAATAATTAACAATGTCCGCTTGACTAACTTATTTGGCCATTTTGGTATTAATATGCCTTTTAAAAATAGATAATCATTGTTTTTTAATTTCATATACATCGTGTTAGTTTTTCTTAATATATCGTGTTATCTTCCTTTTCTTAATTTAAATATAAAATATTTTGTTTAGCTTGTTTGTCCACCTCTTTCCTAAATCTTAAAGCCATCTCTAGAAAAAATTATTTTTGTCACACACTGTTTAACCGAATTTTCAATTGCTCTTCTAGATGCCATCAGTGGCAGTGGGAATGG


Search Again