CR00856

CRIMIC CR00856

Gene Prp19

CG5519

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79322

Images

Construct Sequences

sgRNA sequence
CTCCGGTTCCACATGGGTCTTGG

Amplicon 5' Amplicon 3'
ATGGCGATAAGGATGCCAGGATAACGGCGGCCATAGCCAGCAACATATGGGCGGCCTACGAGAAGCATGGACGCAACGCCTTTCGCGAAGGTCGCCTCACTTTCGTGCTCATCGATTGTGAAAACGGTCATGTGGCCATCACACAGGTGGGTGATCCTCTTTTTTTTAGCAGGGATTCGTTCTATAAAATCTTAACTATATTCCTTTTTACAGGTTGCCAGTGTCCTTTTGTGCCTGTACGCCAAGCAAACGGTGGGATTGGGTCTTCTGAAGCAAAAGGCCATGTCACTGGCCTCCTATTTGGAGCGACCGCTTAAGCAGATCTCGGCCTCATAAGGATAAAACAATGATGTACCAAGTTCCGAAATGAATAAGTTAATAAGTGTATGCATCAAAAGTGAATCAAATGAATATGAATAGTCTGCGGAAAAGTTTAAACGATAATATATTAGTACTTGAAATTATGAATCTTTAAGGATTTTGTTAGTATTTAAGGAAAAACTTGTCTGCTGGTTTCCAAAAGTAACCCAAAGATATTTCGTATTCTGAATTATTTGGATAGAGGGTCAGGTTTATTATTCTGCAAGATTTGTTCAAGAAAACACACAATCATTAGGGAATATTGTATAAGAAAATTTTGGACTTAATTACTAAGTGTGGACTTATTCGATGGCGTAGAGCTTCAGGGTGCGGTCCATGCTGGTGGATGCCAGATACTGGGCGTGCTTGCCGAATCTCACGCCCGTTGCCAGGGCCGTGTGGTCGTTGAATACCTTCAGTTCCTGCCACTGCTTGCACAGGTAAACCCTGTAAATAAAACGAAGCAACCGTCAGAATTTGTATTTGTACCGTGGCAACCAAATAAACAAGTTAACTAAGGGAATCTTCTTTGGCGAATTTAACTTAACAATGCGAAAGTTTAAAAGAAAAGTTTACCGCGAATATGAAAGTAAGTATTATATTCTAATATGCGAAGACTTAAAAATGCATGCTGCTCTTCAAGATTTCGTGCGACCCAAGACCCATGTGGAAC GGAGCCTCCAAAGCCCATAAACTTATCGATTGAGGACTTCAATGCGGTGCGAAATAATTAATTTTTATATTTCCAAAGTTAAGTTTTATTAATATTCCTCAGCGCGGAGAGATCGCCAATCCCCGTGCTCCTTGTGTGGTCACCACCATCGATCCCGATTATATTAAGGACGCCAGTGCGCAACGTTTGGCCAGAAAATTTCGCATGAAAACGTAAGGAATCAAATGAATTATGTGCTGGTGCAATTTCACAGCTTTTTCAGGGACATCCTACTCTTGAGGGAGATTACCCGCAATCGCTTTATGTACTATGCTACGCAAGAACTTTTTTTGGACCGAAAACGCGAGAAGGAATACCAAGACAATGTATACGAAAAGGCCGAGGAGTTTCACAAGTTTGCAGAGGAGTCGCTCAAGAAAATGGAAGCGGAGGAGTTTAAGAAAATGTTAGAGGCCCAAGAAAAGCTGAAGACACTGAAGGAAAGCAAACTGAGCGAAGAGCTGAACGAGGTGAAGCTGGAGCATCAGCGAGTGCTGATGGAAGTGCAGGAGGTCTACGGTCGCTTTCAGTATTTACTCAAACTGATCAGCTACTTTGATGACACAGTTGAGGAGGAGCAAACCGA


Search Again