CR00854

CRIMIC CR00854

Gene CG31751

CG31751

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79321

Images

Construct Sequences

sgRNA sequence
AACTACAACGTTGTCTTATTGGG

Amplicon 5' Amplicon 3'
GCAGATGGCGATCTCCTCAAGCCAGGATCGGACGTGCGCCCAAAAGTGGAGCCCGAGGACGTGGAGAGCCTGCTGCGTCGCCTCTACGGGATCACGATAAGCGAGGTTAAGGAAATCGTCGCCTACGACGATCGCAACTTCTTTGTCAAGGAGGATAGGTAAGCAAAGCGATGACAGTATCTCGCTGACACCCTTTCCCAATCCCGCACCACATCCGGAGGTTTATCTCGTGTATGGGAGTTCAGCGTAAGCATCTCATACAGCTGCAGTCAGATTATTAGCACAGGCAATTTCAAACATCATAATATATCATTTAGATCAGGATTAGTCTTCTATATAGTAAACACAAGAATTCGTTGCTTGAAATAATATCTCCTTTAAAGCATCAACACAACATATTTTCTGTGCTTTGACATGACTGCAATTTTAGCTGCTGTTCGTAGTACGACTGTGCAACACGAAAACAAATAATAATGAGCCGGAGAAATGCGGCGGTATGTAGCATCTATTTATACCCAGTTTAATTAAAGTTGTTAGTCGCGGCAGTTGAGTGTGACGCAGTCGACAGTCACCTTGCCAGCATCGCAATTGCTATCTTGATGGATTCATGGCATTCAGCACTGATGTAGTCAGTTCAGCTCTTCACTTTAATAAATTAGATAAATCTAGAGAACAAAAAGCTTACAATCTAGAAGAGCCATCTATTTGAGGACAGGTTTCGTCTGGAAGCCAAACATGCTGAGCTTGGTTTGATTCTGGCTCACGGCACCCAGTTTTCCATTCGTCCTAGATTTAGGAGTGCCCTTCTTGGCAGTGGAGGGTTTACTCAGCCCCACTCTTCGTTTGCTGGTTGGCAAAAAGTTCTGGCGTTGCTGGCTGGAGGATGAGGTAGATGATGCTCTCTGATCCGAGCTACAGCTGTCGTCCGATAGCAGAATGATGGCATCATTATTGTTCCTGTCGGATTCCTGAGTGGGTTCCGGAGAGTTTTCCAGAAGTAAATCCAGTGACTTAATGCGAATAGTTGTTGAATTGGTATTGCCTTCAGTTGGTATTTGGGGTTGAGAGTTGTTGAGATCTTCTTGGGATTCTAAAGGCGAAGGAACACCTTTATCTTGTGATTCCAAAAGAGAAGAGGCTGTGGTATCTGTATCTGTTTCACCGTCACTGATTTGTGA GGTTCTTCCCTGGAATGTCTTTACATACTAGTCTTAGTTTCTTATGGCCTGAGTGAGAGCTCAGCTTCTGCTCATCCATATCGTCATTTTCCGTATCTCTTAAGTGCTCCCTTTGAAGCCTTGTCTGTTCATCCTGCGTGGCGAAGAAGCGACTTCGGATCTGAACTTGTTCCTTGGCGAATATGCTTCTTTTAAGCGAATCAACCTTTTTTACACCAGCTTCTCCATCCAACGGACTTGCCTTTTTCGGACTAAGCAAACGCAGCAAAGAGGCATTCTCACAAACTACTGGGGATCGCTGATTAGCTTCTTCTCCAGTCCTTTCCTTGGCAAATGGATTGTGCCGACTTTTGTGCACCGGCGACGGAGGAGGTGTACGTTCTTGATCTACAGAATCTTCCCTGCTCGGACTTCTCCTCCTTTTGGCTTTGAAACTGTACATGTTAAACAACTCGGCCTCCGTTTGTTTAGCCTGTTCCAGTCGCTGATTAGCTTCGATTTCCTCGTTTAGAGTTTTGCCCACAAAATCCACTTTTTTGAAGAACAAGGCACACGGATTTTCTTTCTTCGGCGTGTGAGTGTTTTCGCTTTGAAAATTCGTTTGCCAAATACTTTTGTGCTTGGATCGTTTCACGTTCTTCGGCGTTGGCCATGCCTTTTCCGGTGTCCAAGAGTCCAGTCGCTTCATAGAGAAGGGGTTCAAGTTGCCTAGGGCCAAGTGCAAAGCCTGCTCGCTATCCTCCAGCAAGGTGCCAGCATTGCTGCAGTAGCGCTCATCAGTTTCATAATCTTCGAGGGCACACAACCGCTGCATGCGACGCTCTAGCGGGTTGTAGATAAACATGTGCCTGAAGGTGGCCTCCGCTTTCATGAAGTTTTCAATATAGTCGTCATCTACCTGGATTAAAGGATTATTAGTCTTACAATTCAGACCTAACCGCAAGTTAACTTACCTCAAGATTGCGCATATTGAGGTAACTTGGAATCTTTTTTAATGCTATTCGCATGTCTTCCTGTTCCGTTTTTAGTATAAATTTGCACGCCTTGGCCAGTCCGATGCCAGGCAGTGAGTCCAGGTAATCACAGCCGGATAGGATGCACAT


Search Again