CR00853

CRIMIC CR00853

Gene CG31908

CG31908

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79320

Images

Construct Sequences

sgRNA sequence
TTTACCATCGCAACACTAATAGG

Amplicon 5' Amplicon 3'
TGAATCTCAGAATGCCGCGTGGGTTGCGCTTTTCGTTTGATTTTAATTTTTATATATATATATATGTAGAAACATGCATTTGGAATCGAAGTACCAAGTTGAAAATTAGAAGTTATTGAAATAGACAGGACTTGCTCCATTGCCGCAGTCTGTTACCGGCGCATCTGAAAGCCAATGGAGCCATTCGGACAGGGACCCTTGGGCAGGCGCAGGACTAGGTCGTTGAACGGATGCGGATGCTGGCCGAGCTGCTGCGCCTGATGATTCTGATGCTGCTGCTGATGCTGGTGCTGCTGCTGATGCTGCTGCTGGTGCTGCTGTGGCGACTGCAGCGACTGTTGGCGCAGGAGGGCGGCGGACACTGATCCGCCCACAACAGGTGACCAGCTCTGCTGCGGATTGGGCGACGACTGGGGCGGCGCCTGAGCTTGCATCCCAACACCGCCCAGTCCCGATCCTCCGCCTCCGTACGGCGGCAACCGTTGATTGAAATGCTGCGACGGCTGCTGCTGCTGTTGCTGCTGATGCTGATGCTGATGTTGCGGGTTATGCGGATAGTAGTAGTTAAGGCCAGGCTGATTGTGCAGTCCCGGGAAGTAGCTGTTGTAGTTATTATACATCGGCGTCACTTGGGACATTTTCGGTGCCGAACTCGAGCGGTGCATTCCGCCTCCTGGATGGCTACTATTGTTGTTGATGACGTTGTTGTTGCTGATCGCAGAGGGGGGAGTGACAGGCGGCGCCGCGGACGAAACAGCCACACTGCTGCTATTGACAGCTGGCGTGATGGGAGTGGCCCTAAAAAAACAACGAATATGTGCATATGTCTGATTAAATGTGGGTTTCTGTTTAGATATCTCTATAAATTAGACCAAATCATAAAGAAATATTCTAGTATCAAGAAAATATTTATAACAAAGTAAATTATATATATAAACATTGGTCAGTCTTCAACTTCTGAGTGAAATTTTAAGATTAACTTGGATATCGGCAAGATCCTGGTAGGTC GTTGCGATGGTAAATATTGGTCAAACATAAAAGTTATGCTTTCTTAGTACCAAAATAAATCAAATAAAGTAAATTTGGAAACTAAATCAACTTGTTATTGCAACATACGGTTTGTCATCCTCCGGGTTTTTGGCAGCGCCCAGGATGCGCAGCCTGGCCTCGGCGTACTCCTGTTCTCGCTGCTTGAGCGTCTTGATGGGCTGCTTCGGTCGCATTCCGTTAATGTCCCGCCGCTCCTCCGCCTGGGCGGGCCGCCGCAGTATCTTGACGGTCTGGTTGCTGGTGGGCGTGCAATAGGTGGCCGCATCGTAGTCATTGGTCGTCTTGTGCAGCACCATCATGACGGGCTGCTGCTGTTGCTCCTGCTGGGTAGATGAGTCAACCTCTGCTGGCGGTACTTGGGGCTTCCGGGCAATGGTGATCTGCCGTGGCGGGGGATTCCCGCCCCCGTTTCCACCACCGCCGCCACCATCGCCGCTGCTCAGGATTTGTGAGGACTCCTGTACGCTCTGCGGCCGTTGGAGCAATTTCATTTTGTTGACAGGTGGGTCGCTCGTCTGCAGCTTTGTTTGCAGAGTCATAGAGAGCTGGGCAAGAAAAAATAAAAAAAAAGGGGGGGGGGTGTTCCATTGGTTATCAGGTATGATGCTCAATCACATCGCGTGGCGCACTCACCCCATCCTCGTCGATTTCCTCCCAGTTGTCTAACACATCCTCGCCATGGGACATCGTTCGACAAAGCACGTTGCTCGACTGCTGCTAGAATATATACTTCGGGTTTCGGTTGCGTTTTCGCTCACTTTCTTCTCTTGCGCCTGCTGCTGCAGCTCGCACTCTTACTGATACATGATTCCTTCGCACTTTTATCAGACATAAGTTATGCGTATGTTGGCAAGCACACTTTTTTCACGAAATTCGCACCCAAGAACCCTACTGAAAAAACAAAAAACAATACGCAACAATTTGGCCTGCTGCTAATGTCGTTCTCGTTGTTGTTGTTGTTGCTTTCCGTGGGCTAGTCTT


Search Again