CR00852

CRIMIC CR00852

Gene CG5554

CG5554

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79319

Images

Construct Sequences

sgRNA sequence
ACGCCCCTTTATGTTACGTCAGG

Amplicon 5' Amplicon 3'
GCACTGGCTGCAGGTAGTTATGGGCCATTTCTTGTGGCGAGGGAAACTTCCAAAATGTCGAATTTTGTTATGTTTTCGTAAACTTTTATTTTCTTTGTTGTTGTCTGGAGTTATCGATTGCAATAGCGATGGTACAAATGTAGTATTTGTATGCAGTTCAATCGACTTATAAATAGCTTGACATTGCAGAGGCTTCAATAAAATAAGTTATTATAATTAAAATGATTTTGAAGATACGATAAAAATTGAATTTGTATGTAAGAAAACTTGAAGCTTGATCTAATAAATAAAAAATCGTGTAACGAGCGAATACCGACCGAATCCCCCTACCGATGATCTAGCGGGGAATAAAGCGGCTTGCCATCTCCGATGGATATCGAACCAGCACTTCTGTCAATTTTCCAGCAGGCGTCGCAGTTTCTGTAACTTTTTGGAACTGACCAAGACGGAAGCTTTAGTTTAATTTAAGAAACTGTCGCAGCCGAACGTCACAGGTTTCAGGACACGAATCGGCGGAGCAAAGCACCAAAACATCACCACATGCATAGCACATCGTACTTTGTGGCCGCGACATGCGCGGCGCTGCTTCTGCTGGCGGCGACGGCGCAGTCGACGGCAGCAGCGCAGTCAGGACTGCAGCCAGGTGGCAAGTTAATCGAGTTGGACGAGGACAACTGGCACCTGATGCTCCAGGGCGAATGGATGATCGAGTTGTGAGTGCGAAAGGGTGGCTCTGAGTAGTCCCTACCCACATGAAACCCC AACATAAAGGGGCGTGGTGCGCCGGCTTTCTCCAGCCGGCAAGCTGGTTCTTTCGTTCTCCGAAATACCAGACATTCCTTTGCGGCGACGATGACTCATCGGCAGCTGTGTTAAACATATGTTTCTCCCTCCATTCACAGCTTTGCTCCATGGTGCCCGGCCTGCAAGAACCTGGCTCCCACCTGGGAGCGGTTTGCCCGCGTGGCCAAGGATGTCCAGGTGCAGGTGGCCAAAATCGACGTGACAACCTCGCCCTCGCTGAGTGGACGCTTCTTTGTCACCGCCCTCCCCACCATCTACCAGTGAGCACCACATAGACCTTTTCAACCCATGAAATACACATCGTCGTAATCCACGTCAATCATTTCCAGCGTAAAAGATGGCGAGTTCCGGCAGTATCGTGGGGCCCGTGATGGCGACGCCCTCCTCTACTTCGTGAAGAAGCAGCAGTGGCAGAGCATCGAACCGCTGTCCGCCTGGAAGAAGCCCGACACCACCCACATGTCCGTGCTGTCCTACTTCTTCAAGCTTTCGCACACTCTGAAGGTACGTTCACCTAGCCCATTATCGCATCGGTTCACTGCATGAGACATAAGCGGAAGCTTATCAGCGGGTTGATCCCGTTGACCCACAAAAGATTGCCGCCCATCACTCATTACTCTGGTCTTTGCTCTCTGCTGTTGTCTTGTATGTTGGGTTCATGTACTAATAGCATACGCAAAAACTCTTTAAGGACTTCAACGGGCGCCTGCAGGAGGAATACGGACTGCCCACGTGGGGCTCCTACGCCCTCTTCGCCATCGCCACCATCTTCGTGGGCGCTGCCCTGGGGCTGCTGCTCGTGTGCCTTGTGGACTTTG


Search Again