CR00851

CRIMIC CR00851

Gene SamDC

CG5029

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK81148

Images

Construct Sequences

sgRNA sequence
AAAGGACATGTCGGCTGTTTGGG

Amplicon 5' Amplicon 3'
TCACGCAATGCAAACTTTTCAAGGAAATATTTAAATTATATACAATTATAAGAAACTAAAAAACTTAATGCTGTTTTCGAATCTACATAAATTGTCTAAATAAAATAAGGACTTCATAATAGGCTAAGATACAAAAAATATTACTCATTTATTTTTTCAAATAAAATACTCTATACAATTTTTAACAATCACAATAAAACTGGTTAATGTAAAATGAAAATCCAAATTCTACTGTTTTTTTTTAACTATTTGCCTGGGGTATGGGATAAGCAACCGAAAAATCTGTTAAACTAATGATGAGAATTTGAAAAAATATATATTAAAGATATTTAAGTATCTTAATTCGAATAGAAAGGGACTTACATTTTTACCGCCGACTGTTCAATGAGAAATGCTGTAAGTGGAAACATGCTGTTAGACTCCCGAATTATCGATGTAGTACAACAAGCACTCGCATCGATAGTCCCATCGTTTACTTTACATCACCAGGCGTTGTTTTGGTATCAGATCAGATCCATTTGTTATTGCCAGCCAGCAGCATGTTGGAGAACGGTTCGCACTTCTTCGAGGGCGTTGAGAAACTCCTTGAGATTTGGTTTGAGGAGAGCTCCAACGGTGACGATGATCTGCGTAACATCAGCAGGTGAGTCCCTCAACAAGTGCGGAACCCAAACAG CCGACATGTCCTTTGTGCACAAGTGCATGCACAGTTGCGGGCAAAAGTATACGTACATATGCGCCGTTCATTTTCGTCCTGAAAAGAAATGAAATGTATTTCTACACTGATAATTATCTTTTAAACATAACATAGTCCCATTGGAATAGGTTACACATTGGTTTTTAGGCTTATCAGATGCGGCACACGTGTACCTACCCAAATTAAATTGAAGTTTTTATTTATGATTCTCAAGATATACAAATTTGATTTGAAATTTCAAGAAATTAGTTATTAAAGGGAATTTCTTTTTAAACTGGCAGCCTGTAGAACTTTGTAAATTCACTTAGAATTAAGCTTTCAAAAATCGGTCTTAACCCTTGGCCTTGTTTGATAACGAGTTTTAATCAATCCCATTAATCCAATCCTCATTATCTCAAAATAAATTTTGGTCGAGGCATTGTGTACATGTTTATTCAAATAGCCTTGAACTTTTAATGAATGTAAATGATATTTTTCAGATCTGATTGGGAAAACGTGCTTAGCAATGTCAACTGTCAAATAATAAGCACATCCAAAAACGACATTATTGATGCTTTTGTGTTAAGGTATGCGAATATATAAAACTAAACTTAATAAAATATTATTAATTATTTTAAATTTGTATTCGGTGCGAGCAGTGAGAGCAGTATGTTTGTTTCAAAGCGACGATGGATCCTTAAAACTTGTGGAACGACTACTCCATTGAAATGCCTGGGTCAGTTGCTTAAGCTGGCTGAGGCCAATGGATACAATGTGGTCGCAGACTTGTTCTACTCGCGAAAAAATTTCACTAGACCGGAGGCGCAGGTGGGCAAAAAAATTAATTGCATTTCAAATGATTTTATATCATATATATTCAGATAACTCCCCATCAAGGCTTTACGGAGGAAGTTACGTATCTGGACTCAATTTTTCCCAACGGAAGATCCTATTGTCTGGGCTCCATGAACC


Search Again