CR00850

CRIMIC CR00850

Gene spen

CG18497

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTGGCAAGCATCATGAACATTGG

Amplicon 5' Amplicon 3'
TGAAATCGGGGTGGTCAGTGAGCGAAATGCGCCGAGCGAACGAACTGTTTATTAAATGAAGAGCAAATCGCAAGGACAAATAACGTAAGGCAAGCCTTTAACCGTGTAAGAGTGACGGAATAATAAAATATTTAACACTAAAAACCGGTTGGCTATTAAATATAGCAGCAAAGAAAAACGTGGCTCTCCCGGCTTTTTTGCTTCTGTGTTTGTGCTTCTTCGTAGCAGCTTTCGTGTGTGCAAACGCATCAGTGTGTGAGATATTTGTTTGTATGTGTAGCCGCGTAAACAGACGCAGACAAATAAAGGAAGAAGTTGGCGGATTGAGCCGCACGTCAGTTTATTTGGCGCTCGTTTATTTATTTGGCCAAGTGAAATTTTTCGTAGTGCCGATTTATCAATAGTACGAAGAAATCGGGAACGGATAAGCGAACAAAAAACGATAGATTTGGTACATTACTGTTTCCCGATGTTAGCACTAAATGTTGGGGCTCCCGTTTCTGGGGATGATAAATTAAACCGGGATTACCTATGTAGCAAAGCTTACAACGACGATTTTCCCAGCGAGAACCGGTAAATAATATGCGAAGGTGGGTTACTATTCTGGCA ATGCGATGAACATACATTCGTAGTTAAAAAAAAAAAAACAAAACAATGTGGTGGCAACCCTAGTTCAATATATACATATGTATGTATGTACTATATGTATATGCGTATATGTTTTTACCTAGATAATAAAAAAAAAAGTGTTACAAACATATAAAGAAAAAGCAGTAAAAGCTAAATTAATTATGCGTATTATTCTATGTCATAAAATGAAAACGTATTTTTGCCCCTTATTTGTGCGCTATAACAAATACATACATTTTAATGTGTTTCTGAAATTTGATGAATTGTTCTACACTATTTTAGGTCTACAGAGGAACCACCGACAAACAGCTTCGAACGGAATTATTACGACCGCACCACCAGCCGTTTAGTCACGCAGTATCAAGCGAACAACTCAACTTCCTTGGCCAATTCAAACTCCAGTCCCTCGTCCGTGAGCGCCTCCGCGTCAGTCTTCGCTACGGCGGCAGGAGGGTCTTCCGAGAGATCACGCAACCGAGATCGCCCGTACAGGAATGGTTCTGCCAGCGTTCAAGGCGGCGGCATCAACAGCAGCAACACGACGACGACGACAGCAGCCTGCACAGCTGGAGGATCTGGATCGGGAGCAATTGGAACTGGGACTGGGGGTTTGGTAGGCTCAGGTCCTGGGGGAGTACCGCAGGCGCTAGGCGACCGCAGCAGCACCCAGAATATCCACCAGAACCATCAGAGCGCGCGGGTGGCTCCACCACAGTCATGGTACGAAGCCGCCACTGCTGCAACGACGGCCCAATTGAAAAGTTCTGGTGGCAGTGGCAATGCCGGCGCCTCAGCAGCCGTGGGCTTCACAATGAGCAGCTCACCGATCAACCATCATCCGCACCAGCATCCGCATCTTCAGAATCCTCAACACCCGCACTACACCAGCAGTCCAGTGGTAGGAGCCGGATCTT


Search Again