CR00849

CRIMIC CR00849

Gene Dyrk2

CG4551

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79318

Images

Construct Sequences

sgRNA sequence
TTGACTGTACCACTGTAGCACGG

Amplicon 5' Amplicon 3'
AACTTTTTCGTTGCCGTCGGGTAACTTTTAGCATAAATTTGAAATTGGTTTCCCTGCTGGCTGAAATCGAAAAGAGTGTGCCATTGATTGACAAGTGAGTGTGGTGTGGAAAAGCTGTCCTGTCTTCATTTGCATAGCGAATTTTCACGTGTGAAGAATGTTGAAGGCGGAATTAATTTTGCAGCAATCGATTCCACACGACACCATTCGCATAGCACTAATGAGATTCTGGCCATAAAGTTTGACTACAGCTGTGCTTATATATTGCCTTATTTTCTCGTTAATTCCCAAAATGACTATAAATATGCAGAATTAAGAGGCTTAACCAAAAGGATGCCTATCCATTAATGATGCTGTGTCCCTGGCTGGGACATTTGTGACCTTGCCTTTCATTCGCCCAAGGACCGGCTAAATTTTCTCACAAAAATATCCGTTTTTTTTTTTGCCCATCGCATTTTGCGGCATTTTAATTAGTCGACGGCTTACTTCGCAGTTGAACCGTAAATAATCTCAGAAATGCAGAGAAAAATTCCTGCCACAGCCCGGGGAAGTGGTGTGGAACTAGGGGCGAATTTACCTTTTAGTAGATGATAAATGACTTGGCCTTGGCCATGTCAACTGGCTTCTATCTTCCACCGCGA GCTGACTGCTCGGGAAATGTCAATTAGCAGTAATTACTGTGCCATGGTACGGCATAATAATAACCTACATCAACATCCGTGGAACAGCTGACACCGACACTCCTTTGCCCCGCGTCCAAATGAAAATATCGCCCCCATCGAGTGTTTATTCTCCTGGTAACTCAATCCGCCGACTCGTCCTTGCCGCCCGTTCCTAATTGCGATTTACACGCGCTGAGTGCAAAAATTAATTAAAAAGAATAAACTTGCAGGACCTGCTCATTTGCATGGTCACGCCCACAGCTCACGCACGCCGCATGTTGCATTTTAATTAAAAATCATTTCGTCCTGTCGGCCCATCCGTTTGGCCCACATGACCAAAAGGCAGCGGAATGCCGACGACATCCTGTCACCTTTCTATGTCACTCTCACGTTGTCAGCGGCCATGTCCTGGAACAGTCAATTACATGGCTGATGACAGGCGGTCACATGCTGCATCTGTGCGACATTGATTGGCTTTGAAATGGATAAGTCGACGAGGTTTGCAAAAAGCAATTGCTTTCCGATCGATTGGAAAATACAAAATCACAAAATATGTGGTCAATATGTTGACTAATTACCTCAACTTAATCGACTTTAAGTGAACTCCCTCCGGACTTTTTAATTGCATTTTCGTTTCGTTTTTGGTTTAATTCGAATATGAAATTAGTAATCTCATTTATTTTATCCCCCTGTCGATCAATATTTATTGCCAATTGCTTTATTTTATCAATAATGAGCAAATCCCCTTAAACTGTATGCACTCGTTAATTTGAGCAATAAATTCTGGGGTGATTATCGCCAACTTGATCTCCTTATGAGCCATTAAAATTGAAATCAAATCATGACACATTGCATAGCGAAAACCCGCCGAGTTGAGAGAGAGGAACGCAGTGACATTGGAGGCGGAGCAGTCAGGCGCGGCAGGACACTTTCCTCCCGGGCAACATTAGCTGAAATTTATGTGCTTGACACACACCCACAGACACAAACTCACACACACACACACACAGAGCGAATTTCGCTATATCCACGAGGCCACGAGGCTCGAGCATTTTCTTTTGGCCAAAAAGAAGCAGCGTCATTCTCGGTGGGACAATATGGTGCATAGTTATGGGGGCTCGGAATGTGTTGGCTGTCTTTGGCACTTTGG


Search Again