CR00848

CRIMIC CR00848

Gene lig

CG8715

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79317

Images

Construct Sequences

sgRNA sequence
TTAGGTGCGGAGCGCGATTGCGG

Amplicon 5' Amplicon 3'
GACCAAGAGCGATCCCTACGGACAGACGGGCGGCAGTGGTAACGCCTACCAAAACGCGTACCAGAGCAGTGGAGCGAGTAAGACAGCCAGTGGCTTTCCGACGACCGCGCCCGGTGGCTACAGCAGCTCCACATACGCGAATGTGCAAAGCTCAGTAGCCAACAGTTACCAGCAGCAGGGATACGGCTCATACCAGCCCAGTTCCTACCAGCAGCAGGCTGGCAGCGGGGCTCAAAGCGGTACAGGTGCGGTAAGCGGAGGCGGAGGAACGGCGACGCAAAACATTCCGGTTGGAGGCAGCAGCAGCCAAAATAGCACGAGGTATGACATGATCCAGTATTGATTGTTTAATATTTAATTCCAAAGGGTACGTACCCTTGCAGAGATTCGTAGTTACATATTTCTTAAATTTAAAAATTATTTCTAAGCAACAAGTCGATTTGGCAAGGAACAACTAACTATACTCAGCAAGGGTACAAACCTTATCGAATATATCTTTTACTTCAAAGTTTAAATATTTGTGTGTATGCAAGTTTTGCTTAACAATTAGCCCCACCCGAAAGAGAGCTAATCTTCATTTTGTTTACTGTTTTTCTTCTCTCCTAACACATTTAATGCTCGCTTATGTCCCAAAAATCCCAAACCGCA GCACCTAACAGCGGCAATGCGAGCTCTGCCTACCTCACATCCGGATATTCGACACCACAAAGTGCTTACCAGTCAAGCCAGAGTGTTTATGGCAACACTGGACTGTCCAACAGCAGCGGGTAAGTACCAAATGTGACGATCCCAATCCCAATACGATCAGTTCCCTGGGGATGACACGTACCTTATTTTGCTTGTTTGGACTGGTTCTGGTTCCATTATGCTTAATTGCGGCTTCTCGCCCGTTCGTTCAGGTTCTCTGGCAGTGCGAGCAACGCGTCCTCGCAGTACGCCAATTTCAGTGCCAGCGCCAAGCTAAAGGATGCGACCACGGCCAGTAGCGCCGCTCATTACGACAGGTAAGAGCGAAACCCCCGCTCTGCATGCCCCGCTTTTTCAAATATTCCGACTAACCCAACCCCCTGGTCATATCCCACTTAGAGGCGGATGCCTGTAGCACTTAATGTTGATCTTATTGACCTTTCAGTGTCTCAACCAGCAGCGGAGTGAGCAGCAACAGCGGAAGCACAGGCAATGGCGGTGTGGTGAGCGGTCAAACAGGTGCTAACCAGGCGGCTGTATCGAACAGTAAGTAATCGATGATTTAATATCAAACAGTTGAGGCCCTAAAGAGTATGCATTGCAGTCATTAAGCTTTCTGGTATAGAAATCCCATATCAAAAATATTTAAAAACAAACTCACAATGTCAAATCTACTTCAATCTAGCCACGGCTTTGACAATACAACTCTCCAAAATAAATATAATTTTTGATTCAAACTTTTTGTTTAGCTGAAATGCTCTATTTTTGGCCGAATTCTTAGTATTCGCATTTAAACTAAAACCTTTCCGTCCTCTCCAGATAACAGCGTGAGCGGCAGCAGCTCGGTCAGCAATGTGACGGCAGGCGTTGCGAGTGGCAACGTAGCTGGCGTGGGCGGAGGCGTAAGCCAGAGCGGCGTAAGTAGTGGAGTCGG


Search Again