CR00847

CRIMIC CR00847

Gene dare

CG12390

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79316

Images

Construct Sequences

sgRNA sequence
CGTGCACACGCAATCGTGTGCGG

Amplicon 5' Amplicon 3'
ATTGGGCAGCTTGAGCATCTCCCTCAGCTCCTTAATGGTGAAGGCAGCTTGCAGAGGACCTCGTCGGCCAACCAAATGGACTCGTTCCACTTGGCTGCAAGAAAGCGCTTCCAAGGCGTACTCAGTTGTGTCCGTAGTCTGTAACAATGCACATGAGAATCGTGGAATTGTTTGGGTATTAAAAAGAAACTCACCTTCAAAGCATCCAAGGGACTGAGCAGCATCCTAGCCACATCCACAGCCACGTTTCCCTGACCCACAATCGTGACATCGCGACCGCTCAGATCCGGAGCCAAGTTTTCCGCACCCGGCAATCCATTATACCAGGCCACAAATTTCCGGGCTGATATCACATTATCCAACTGCTCGTTCTCCAGCTCTAGTTGCCGATCCTGGTCCGCTCCGTAGGTGAGGAGCACGGCATGGTATCGATCTCTTAGCTCACGCAGGCTGACATCCGTACCCAGCGATATGTTGCCAAAGTAACGCAGACGCGGATGCTCGGCGGTCTTGGTGAAGGTGTTGATTACGTTCTTGACCTCCGGATGATCGGGCGCAACGCCAAAGCTGCAATGTGCGATTTGCATAATGGGACAAGTCGTTAGTCGATAAGTGCGATGGAATGCCGT GCATTTGATTTCGGAGTGGTTGTCACAGTTTGTATTCCAAGATGCAGGTGCTAGGCGGCAATCCACTCAGCTTGTGTCTCTTGGTGATCATCACTCCGTCACTGATTGCAGCCAATCCCCTGTGGAGTCTTGACCAGGTGGGAGGTATGTTTACATTACCCCTGGATTTCTGGCAAGGATTACACACATGTCGATCTCTTCAGCATACTTCACTGGCATCTTCCGCTCCGTAGTGGGTCCAATATTTGGCTTTGGCCTGGCAGCCAACAGCACCGCCTTATAAAGATTGTTCTGCTTACCGCACCAGTCCGAAGGGAACCGGCAGCTTCTCGACCACATCCACCACGCAATTGTCCAGCTGCTTGAGGATCAATTGGGCGGCATAGAAGCCGGCGGGTCCGGCGCCTACGATGCATATCCGCTTGGTGGGCGTGGTGCTCTGGATCACCTGCAATCGGGCGGAACTCGTGTGGAGGCCACGTCTGAAGATGTTAAGGCAATTGATGCCCATCGTGGATCAGTCGCCGATCTCTG


Search Again