CR00846

CRIMIC CR00846

Gene cni

CG5855

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79315

Images

Construct Sequences

sgRNA sequence
ATAATGTGATTTGAGATCCGAGG

Amplicon 5' Amplicon 3'
CCGCTGTCCCTCATGCTAAACAGAAAAATGAAAATTGGTTACATTGATTTGACTTTTATTTAATGCTTAAAATCCAACTACACCAAAGATGCGATATGCAAAAAATAATCAAAATAAAAACATGTTACAATCTCTTACTGCAGAAAAGTATTACAAATTGTATGAAAAAAACAAAGCTTCAAGATGTCTTTATGGATTTACACTAGAATTTACAAGTGAAGTATTGTTCGCGGTTGATGGGGACTCTTCCCCAAAAAAGGAAGTCCTCTACCCGAGTTTAGACAACTAATACACGACGCTGATGCGTTGGCGCCAACACTGAGATCCCCAGGCAAGAGCTTGCCTATGTCGAGATGAGCGAATAAACCATGCTAAAATTAGCAATTAGAAACGTTAGACAAATGAGGACCCTGGCCACAATGAATCTCAATTAGACTTACCCGTATATGTAGTAGAAGAAGCTAATCAGATAGACGGCCAGTTTAATCCAACCCTCACGCATGTTCCGGTACAAAGTATCGGTTTTCAGGACCGTGGTGGGATCATAAAGTCCGGGTCCCGACATCACAGGGCGGTTTTTGTAACTGAAAGCGATAGGGGTATTACAAAGCATGAGTGCTTAAGGGTGCTTATGTTGGGCTTGGGTGAATCTTGATCTCCTCGGATCTCA TCACACGGTCAAATGAGTCACTTACCGCCAAATATGATAGGCTATGAGGGGTATGTTGATGCATAGCGAAAACCATTCGCCGCAGAACAAGAAGAGCAAGTTCAGAAAGATGTGCAGAAGGTATTCGGGCAAAACCAGCTGAAATGCAAACACATACATTACAGGGCGCACTGCGGGTGTAAGCAGTAAGTTTACTGACCGGATTGAGGCTATTGCACTGATCAATTGGGTTCTTATAATCCGTTTTAAGTTCGTCGAATGCAATGACATGAAATATGGCGAAAAATATCAAGAATGCATCCCCGATCAGGGCCACTATGTACGTGAAGGCGGTGAAGTTGAAGGCCATCTTGTAAAATCGCTGGAGCACGTCTTCCAGGTGCTAATCAAAGTGACTTGCTAATTATTATCGTAAAATTCGGCTTTGCAATTGTAGCGCTGGGACTCACTTGTTTTTTTTTTACAAGGGCGGCGATGATGACAGCTGTGCGCCAGGGATGCACTAATCT


Search Again