CR00845

CRIMIC CR00845

Gene Sema1b

CG6446

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79314

Images

Construct Sequences

sgRNA sequence
CTTGGGATATGATTGTCGGCGGG

Amplicon 5' Amplicon 3'
CAACAAAGTCCGGCTGGTTGAGTTGCTTGAGATCATATTGTTCGGTACGCAGGTTCTCCCTGTAGATGAGAGGATCTCCACCCGAAAAGTCCGCCACGGTGGCGCTGTACAAATGCCCGTCGGCGAAGGCGTACGTGCTATTGTGGGCGGGGCTGTAGGGGCACAGGCCCTGGGCCTCCACATCTCGGCTGACTTCGTAGCGCATGGCATGGGCGTGACCAGCAGAGCCGGCCTCCTCGGATGACACTTCCACCGGCGTGTAGTGACGACAGCGCGGCTTATACGAATTGGTGCCGCAGAGCAGCACCTCGCCATTGGGACGCAGTGCATAGACGCGAAGGTAGTTATGGCAATCCCACTCGTGCTTCCCCTTTAGGGCACACAGCTCCCGGTCCGCATCCGTGCTGTGCCACTCCAGACGCGCAATCTCCTTCAGGCCATTTAGGCTCACATTGTAGATGACGTCCCTGCAAATCGAGATAGAGAACAATTGAATAAACAAATGCGAGAATTAATACGCCGATGGCGTGTGCCTGCCCAGAATGTGAAATGGAATGGAAGCCAGCCAAGTACGGTGACCAAAAATAAACGACAAAAAACCCGTGAGTTGAGAGCTTCGTGACAGGAGCATACAAATGTTTGACTGAACAGTGCCGGTTAAAGTAATAGTTTTGAATAAGAACTATTGATAGATGTGTAAGCAAAGTACCTTACTTTCTTTGGCTCAAATACATTTGTTAATACAGCCTTAGCCTTAAGCAACGATTTTGCGACATTTCATTTTATTTAAGTAATCAAAAGCTTAAAAAGTAAACACTTGTTAGCAAGTTTTACAATTAATAAACAACGTGTTTTTTCATTAGCGACAGCCCAGGGTATTATTATTTCTTCACTTTGCATTAGAGCTTTTTCAAGAGCACACTACTATTATTTTGACCGCATCTGTTTTTACGCCCCGCCGACAATCATATCCCA ATCCCAAGGTTGCCTGTGTGCAAATAATTAGAACTTGTACACAATTGTATAATTCAGCGTTTTAAGTGGCTAATTATTGTTGCTGCTAATTTGTTGCTATGTTCTTTATGGCACCAGCACGTCTGGGGCGCAAGAAAAATATGATAGATCGAAAGCTGGTTTGCATTTGTCGGTCCATTTCAGATCGCCGATAGCTGATTATTAGTCACCCAAATGGTAGTTTGCGTGGCTCTCATGTAAATGGTAATTATAAAATGTACATTATCGAAAAACCTATGCATTTAATATTTTTCAGTTAATAAATGTATATACCAGACTTCGTTGAAACGTGATAAAAAAAATAATGCCTTCTGACTTAACTTTGTTCATGAGCAATATAATTATATGGATGAAACTGAGCAAGTGTTATTTATTCCAGACCTTTGTATCTCGCCAATGCCAAATCACTTCGACTTCCCGGAAAGGGAATGAGAAATGCTAGATTTGCACTTGCCACTAATGAAAAACGAATACCAAGCCAAGCGGCCAATAAATCGGTAGAGTAAAGTAATGCCAAATGGCGAGCTAATTATTCCGAATCGGACGCTGTATAATTGTGTTTTTATAAATATTTAAACGTGTTCGTGCCAAGTTTATTTGCGCACAGGTAGCTTGCTCGGTAGCGGGAACTTTTTTATTGCTTGCCAGAAATCAAAGGGATCGTAAAAGAATGTTAAAGAAATTCACTCACTTGGCACCAACTAGAACAAACTCATCGTTGTGGTCCAAAATCTTGAAATAGTCCGTCGAGTTGCCTATAAAATGGGCTAGGACTTTGTCTTGTTCTGCAAAGAAAGAAAGAAGCAAAGTGAAATGTTATTGACTGCTGGGATTATATAACTTGTGCGTTTACTCGTGTTTTTTTTTTTTTTTTTTTTGAGATCTTGCACAATTTCATTTTAATTTCTGTTTAACTCGATTCAGAGGAAATGCTAGCGCTTGTTGCTGCTGGCATTGCGAAAATTCCGCCTGATAAGCAGCTTGGAAAATCGGAGCTTAGCTTGAACAGCCTCGCTTTTGTCATTGATAAACCAGCAGCAACAAGACCGGAAAGCAA


Search Again