CR00844

CRIMIC CR00844

Gene cl

CG11024

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79313

Images

Construct Sequences

sgRNA sequence
TACCACGGTTCAGTGATAACAGG

Amplicon 5' Amplicon 3'
GTCCACGTCCTCTTCAGTGGCGGCAAGGACGAGAAAGGAGAGAGCTGGTGCCCCTACTGCGTCAAGGGTGAGCATGCCGTGATCCCAATGCGGCTAACCGCAACCTATCCGATTCCCAAACTCATTTCTCACGTTTGCAGCGGAGCCGGTGATACACGATGCGCTGAAGAAGGCCCCGGGCAACTCGCACTTCGTGCATGTGGATGTGGGCGAGCGGGCATAGTAAGTTAATACCGCCAAACTGAAGAAAACAGCTGCGATTAGTTAGATAAGCAGGAATTAATATTTCATGCACTGCGAGACTGCGAACATCTGCTGGTTTCTTTGGTTCGAAATAGCCAAATAGTTTCAAAACACAGGCTTAGTCATTTAGAATGACGTACATATATGCATATATCCCACGTCATTCAGTTGCCAAAACCCTTTGTCATTCGATTATCAAGTTCAAAACATTTTGGCAATGTGAAACTAGTCACTCAACCCCAACTGTACGATGATGAAATAAGCACTCGAGTACTTTTTCACACGCCGAGAACATTCATGATAAAAAAAACCATTAAACAACGATAGCTTTACAATGCTCTTGAGTTGTATTCATGCCGCCTGTTATCACTGAA TCACTGAACCGTGGTAAGCAATAAATTAACACTTGTTTTTCACTGCAGCTGGAAGGATTTGAACTGCCCCTTCCGCAAGGATCCCAACACGCATCTGATCTTCTTGCCCACTCTGTTGCGCTGGAAGCGGCCACAGCGTCTGGATGGCGAGCGCTGCTCCAATCAGGATCTCGTCGAGATGATGTTCGAGGATGAGGATTAAGTCGTATACCTTACATACATTTATTTTGGAACTTTACTCAATTTGGAATACACAGAAGACACACACACAGATTCAATTAAAGCGTCCCTCAGTAATTGCTCTTGTACTTCTTGATCTCCACCATCACGACGTGGATATTGGTCAGCTGGGCGCGGGCATTGGGCGTGAGGAGCTTGTGGAATCGGTGATAGTATTGCACCAAACTGGCCAACGCAAGCTGCAGAAGCTGTGAGCCCGTCAGCAATGAGGGAAATGAGAGAAGCACCTCCCTGTTTAGCTCCTCCAGAGATTTCTTCCAATTGGCCGAGAAGCTGGCGACCAAGGCCAGACTTCTTCGCTCCTGTTTGCGCAGCTCATCCATTTGTTCCTTCTCGAAGAAGTGCTCGCACTCCTTGACGAACTGAATAATGCCTCCGAAATGAGGGGCCAGGATCTCCTCGACATATTCCGCACTGCGGGAGTTGAGCTGCTCTCTGAATGCCTCCGCTTCTTTGGAGTTATCTCGCGTGTGCTCCATC


Search Again